We narrowed to 18,496 results for: RAN-1
-
Plasmid#84826PurposeMinimos transposon with Psmu-1:smu-1:GFP:smu-1 UTR and cbr-unc-119 selectionDepositorInsertsmu-1 (smu-1 Nematode)
UseTagsGFPExpressionBacterial and WormMutationPromoterPsmu-1Available sinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mucolipin1 D471-472K-pHcRed C1
Plasmid#62961Purposefull length human Mucolipin-1 D471/472K cloned into pHcRed1 C1DepositorInsertMucolipin-1 (MCOLN1 Human)
UseTagsHcRedExpressionMammalianMutationD471/472K (and two silent mutations T77 ACA inst…PromoterCMVAvailable sinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8 Flag3HuR
Plasmid#135950PurposeExpresses HuR in mammalian cells. Can also be used to generate mRNA for zebrafish expression.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseTagsFlag3ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
3XFlag-TMCC1
Plasmid#121045PurposeExpresses human TMCC1 in mammalian cellsDepositorInsertTrans membrane and coiled coil domain containing protein 1 (TMCC1 Human)
UseTags3x-FlagExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-TMCC1
Plasmid#120931PurposeExpresses human TMCC1 in mammalian cellsDepositorInsertTrans membrane and coiled coil domain containing protein 1 (TMCC1 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TMCC1
Plasmid#120932PurposeExpresses human TMCC1 in mammalian cellsDepositorInsertTrans membrane and coiled coil domain containing protein 1 (TMCC1 Human)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::lite-1G::SL2::his-24::tagBFP
Plasmid#232610PurposePan-neuronal expression of 'LITE-1' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorInsertLITE-1 (lite-1 Nematode)
UseTagsExpressionWormMutationN/APromoterAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
UseTagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCPromoterAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaPromoterAvailable sinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pV92.2
Plasmid#78409PurposepKT230 plasmid engineered with the RTCas1v2-GFP cassette (RT-Cas1, Cas2, GFP) driven by the MMB-1 16S rRNA promoter, the CRISPR03 array driven by its native leader, and the tmRNA::td intron constructDepositorInsertsRT-Cas1
Cas2
UseTagsExpressionMutationPromoterAvailable sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALFY-FYVE 1G
Plasmid#197045PurposeExpression plasmid for the FYVE domain from ALFY for recombinant expression in E. coli.DepositorInsertALFY (WDFY3 Human)
UseTags6xHis-GST-TEVExpressionBacterialMutationPromoterAvailable sinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0121
Plasmid#177053PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of iridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus driven by 35S promoterDepositorInsertiridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0117
Plasmid#177049PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of iridoid synthase (CrISY) from Catharanthus roseus driven by 35S promoterDepositorInsertiridoid synthase (CrISY) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0108
Plasmid#177041PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of geranyl pyrophosphate synthase (PaGPPS1) from Picea abies driven by 35S promoterDepositorInsertgeranyl pyrophosphate synthase (PaGPPS1) from Picea abies
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0911
Plasmid#177067PurposeMoClo Level 1, position 5, transcriptional unit for transient expression of loganic acid O-methyltransferase (MsLAMT) from Mitragyna speciosa driven by 35S promoterDepositorInsertloganic acid O-methyltransferase (MsLAMT) from Mitragyna speciosa
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0771
Plasmid#177061PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of secologanin synthase (CrSLS1) from Catharanthus roseus driven by 35S promoterDepositorInsertsecologanin synthase (CrSLS1) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0775
Plasmid#177065PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of strictosidine synthase (CrSTR) from Catharanthus roseus driven by 35S promoterDepositorInsertstrictosidine synthase (CrSTR) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWH-IRP
Plasmid#133896PurposePositive control when used with pMS22H-IRE. Expression of Gal4AD-IRP hybrid protein. Homology regions for recombination with pMS22HDepositorInsertIRP
UseTagsExpressionYeastMutationPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-Stx3-L77A/L80A
Plasmid#100273PurposeExpresses GST-Stx3-L77A/L80A in bacteria.DepositorInsertStx3-1-265-L77A/L80A (Stx3 Rat)
UseTagsGSTExpressionBacterialMutationNo transmembrane domain; residues 4-264 present, …PromoterTacAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-Stx3-E78A/E83A
Plasmid#100272PurposeExpresses GST-Stx3-E78A/E83A in bacteria.DepositorInsertStx3-1-265-E78A/E83A (Stx3 Rat)
UseTagsGSTExpressionBacterialMutationNo transmembrane domain; residues 4-264 present, …PromoterTacAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only