We narrowed to 2,527 results for: T2A
-
Plasmid#184089Purposecyclofen-inducible chicken EN2 (mut) activation in zebrafish permanent transgenicDepositorInsert5myc-chkEn2(SR)-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationchkEn2: W247S, F248R; ERT2: G400V, M543A, L544A, …PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22iuasvApoWChe(#488)
Plasmid#184108Purposecyclofen-inducible apoptosis activation and imaging (mCherry) in zebrafish permanent transgenicDepositorInsertmyr-DIAP1-nls'-mCherry-P2A-Casp9-ERT2
UseZebrafish transgenesis (blue eyes)MutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …Promoter4xUASAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2iU6Apowriter2N(#355)
Plasmid#184106Purposecyclofen-inducible apoptosis activation and imaging (tEosFP) by zebrafish transient transgenesis or mRNA synthesisDepositorInsertmyr-DIAP1-5myc-tEosFP-nls'-P2A-Casp9-ERT2
UseZebrafish transient transgenesis + in vitro trans…Tagsinternal tag: 5mycMutationDIAP1: deleted 1-2, N19G, N20V, deleted 146-438; …PromoterZf-Ubi+SP6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
P3-Lenti-dCas9-Tet1-GFP
Plasmid#190729PurposeLentiviral construct to express spdCas9-Tet1-GFP.DepositorInsertdCas9-tet1
UseCRISPRTagsSV40 NLS and T2A-EGFPExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterUbCAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-CuOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-hNIL
Plasmid#197089PurposePiggyBac plasmid with tet-inducible expression of transcription factors for motor neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYJA5
Plasmid#217778PurposeThe empty vector for quadruple sgRNA cloningDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsPuromycin resistance gene, T2A, and TagBFPExpressionMammalianPromoterPGK, CMV, U6Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-hOKMSOX17FNV
Plasmid#206382PurposeExpresses four genes (human OCT4, KLF4, c-MYC, SOX17FNV) in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-OSKM
Plasmid#20328PurposeLentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generationDepositorUseLentiviralExpressionMammalianAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-FastFUCCI-IRES-3xnls-mTagBFP2 (JDW 1511)
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-A
Plasmid#200824PurposeAAV transfer plasmid encoding a circularized RNA barcode A under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-mgp100-PuroR [M1G]
Plasmid#171802PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-B
Plasmid#200825PurposeAAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-C
Plasmid#200826PurposeAAV transfer plasmid encoding a circularized RNA barcode C under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-D
Plasmid#200827PurposeAAV transfer plasmid encoding a circularized RNA barcode D under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-PuroR [M1G]
Plasmid#171813PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_Ngn2-ISL1-LHX3_Down-Tandem
Plasmid#241396PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of Ngn2, ISL1 and LHX3DepositorTagsNLSExpressionMammalianPromoterTRE; CAGAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only