We narrowed to 3,505 results for: cgas
-
-
non-targeting control gRNA (BRDN0001145269)
Plasmid#80249Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgNGN3_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162336PurposeLentiviral expression of sgNGN3 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6; mU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145885)
Plasmid#80196Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
NUAK1 gRNA (BRDN0001145557)
Plasmid#75575Purpose3rd generation lentiviral gRNA plasmid targeting human NUAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA1
Plasmid#59303PurposeKnockdown of human FOXH1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shId2 #2
Plasmid#83090PurposeLentiviral shRNA vector for inducible knockdown of mouse Id2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001147832)
Plasmid#77321Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK4 gRNA (BRDN0001147629)
Plasmid#77573Purpose3rd generation lentiviral gRNA plasmid targeting human PAK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMB2_sgRNA_1
Plasmid#74184Purposelentiviral vector expressing sgRNA targeting PSMB2DepositorInsertPSMB2 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146476)
Plasmid#80194Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
ULK2 gRNA (BRDN0001147288)
Plasmid#77262Purpose3rd generation lentiviral gRNA plasmid targeting human ULK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001148252)
Plasmid#77955Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
