We narrowed to 24,925 results for: crispr
-
Plasmid#197030PurposeVector encoding a human codon-optimized miniCRISPRoff-v1 driven by CBh promoter, guide RNAs compatible with enOsCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized miniCRISRPoff-v1
ExpressionMammalianMutationD52R / T132R / D228A / D406APromoterCBh, CMV, hU6Available sinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6gRNA1-U6gRNA2-TnT-Cre
Plasmid#87682PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.DepositorInsertsgRNA1
gRNA2
Cre
UseAAVPromoterU6 and cTnTAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBT372
Plasmid#125613PurposeExpresses evoCDA1-BE4max-NG in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertevoCDA1-BE4max-NG
ExpressionMammalianMutationF23S A123V I195FAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-PE2-C
Plasmid#164908PurposeExpresses the C-terminal split-intein fragment of PE2DepositorInsertPE2-C
UseAAVAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCas9
Gam, Beta, Exo
I-scel
Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMS2M-PH-gagpol-D64V
Plasmid#166031PurposeExpression of bacteriophage-derived MS2 coat protein fused HIV-1 Lentiviral Gag-Pol at N terminal with a HIV-1 protease cleavage signal between MS2 and Gag-Pol.DepositorInsertMS2-Gag-Pol
UseLentiviralMutationD64V mutation within the integrase within PolAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAGM4723:TpCC_Urease
Plasmid#85982PurposeGolden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAsDepositorInsertsCas9
Urease-targeting gRNA 1
Urease-targeting gRNA 2
UseCRISPR; Diatom (t. pseudonana)TagsNLS and YFPPromoterFCP and U6Available sinceJan. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEJ7-GFP variant of EGFP
ExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBsVchCAST-pyrE
Plasmid#203813PurposeExpression of CRISPR-associated transposases, shuttle vector for Bacillus subtilis / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(pyrE)
UseCRISPRExpressionBacterialAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgSEC61B.N1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216251PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgSEC61B.N1 to tag endogenous SEC61B N-terminusDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 and sgSEC61B.N1 (SEC61B Human)
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
RED
Plasmid#139835PurposeExpresses RNase H1-EGFP- dCas9 fusion protein in human cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRNase H1-EGFP-dCas9 (RNASEH1 RNase H1 (H. sapiens), dCas9 (S. pyogenes))
ExpressionMammalianMutationdCas9 protein contains two mutations: D10A and H8…Promotertet-inducible CMVAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJR103
Plasmid#187242PurposeLentiviral sgRNA vector with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expression
UseLentiviralAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-Flag-HFSpCas9-H840A
Plasmid#80455Purposehigh fidelity SpCas9 mammalian expression vectorDepositorInsertHFSpCas9_H840A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable sinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hDNMT3B_KO_puro
Plasmid#234998PurposeStable knockout of DNMT3B function in mammalian cellsDepositorInserthCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKM126
Plasmid#105134PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid Tn916 oriTDepositorInsertsUpstream & Downstream pyrE deletion region
tetR
Cas9
gRNA
UseE. coli - c. difficile shuttle vectorAvailable sinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7
Plasmid#173204PurposeExpresses the ATP1A1 G7 sgRNA in combination with SpCas9 to target ATP1A1 intron 17.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G7 sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
dRED
Plasmid#139836PurposeExpresses dRNase H1-EGFP-dCas9 fusion protein in human cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdRNase H1-EGFP-dCas9 (RNASEH1 dRNase H1 (H. sapiens), dCas9 (S. pyogenes))
ExpressionMammalianMutationRNase H1 protein contains D210N mutation. dCas9 …Promotertet-inducible CMVAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by