We narrowed to 5,036 results for: U6...
-
Plasmid#213707PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag TST-EGFP-GPIBY55 driven by an hPGK promoter.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterhPGKAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide2 in pX458
Plasmid#211536PurposesgRNA-2 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide1 in pX458
Plasmid#211535PurposesgRNA-1 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-ctfR1
Plasmid#207992PurposeCRISPR vector used with pAf-CRISPR-phoA (#207991) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertctfR1
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACBE-ASR (pXK-607)
Plasmid#208822PurposeUniversal Antibiotic Screening Reporter for adenine and cytosine base editors. Key Construct: CMV-PuroR*(ATAACG)-eGFP-hU6-gRNA.DepositorTypeEmpty backboneTagsEGFPExpressionMammalianPromoterCMV, U6Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACBE-FSR (pXK-1648)
Plasmid#208821PurposeUniversal Fluorescent Surrogate Reporter for adenine and cytosine base editors. Key Construct: CMV-mCherry-CMV-eGFP* (ATAACG)-hU6-gRNA.DepositorTypeEmpty backboneTagsEGFPExpressionMammalianPromoterCMV, U6Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-sgHPRT1
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1a/hU6Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC mTagBFP2-Synapsin1a
Plasmid#191567PurposeExpresses an shRNA and mTagBFP2-synapsin1aDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterU6 for shRNAAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_1
Plasmid#190700PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 1
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_2
Plasmid#190701PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 2
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_3
Plasmid#190702PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 3
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole4 KO sgRNA
Plasmid#186935PurposePole4 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole3 KO sgRNA
Plasmid#186934PurposePole3 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-3xHA-Syn-smFP-flag
Plasmid#182563PurposeFor mouse Nav1.6 knockin with 3xHA at the C-terminalDepositorInsertsmouse Scn8a gRNA and 3xHA donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-HaloTag-V5-EF1-sfGFP
Plasmid#182565PurposeFor mouse Nav1.6 knockin with HaloTag-V5 at the C-terminalDepositorInsertsmouse Scn8a gRNA and HaloTag-V5 donor DNA
sfGFP
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn8a-3xV5-EF1-smFP-flag
Plasmid#182562PurposeFor mouse Nav1.6 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn8a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJF449_dpy-10_CDS_sg1
Plasmid#163866PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only