We narrowed to 2,374 results for: tub
-
Plasmid#207794PurposeDonor template to insert moxGFP-2A-Puro into the C-terminus of the MAPRE1 locus for growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 Addgene #207793DepositorInsertMAPRE1 Homology Arms flanking a moxGFP-Puro Cassette (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDEST-CMV 3xFLAG-LC3B-G120A-GFP
Plasmid#123108PurposeExpresses 3xFLAG-LC3B-G120A-EGFP in mammalian cells, negative control for monitoring ATG4 activity.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
Tags3xFLAG and EGFPExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSRG12 (eft-3p::24xGCN4::t2a::tagbfp::h2b::tbb-2 3’UTR)
Plasmid#245120PurposeSunTag reporter for live imaging of translation (when combined with scFv::GFP expression) in C. elegansDepositorInsertseft-3p
24xGCN4
T2A
TagBFP (GLO)
H2B
tbb-2 3'UTR
right recombination arm MosSCI cxTi10816
Left recombination arm MosSCI cxTi10816
ExpressionBacterial and WormAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa_R551Q:polyA
Plasmid#193013PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa R551Q patient variant in neuronsDepositorInsertsUseTransposon transgenesisExpressionMammalianMutationENST00000287842, NM_013956, c.1652G>A, p.(Arg5…Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-RFP-LC3ΔG
Plasmid#84572PurposeExpresses GFP-LC3-RFP-LC3ΔG in mammalian cells to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseRetroviralTagsEGFP and mRFP1ExpressionMammalianAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs GFP-LC3-RFP
Plasmid#117413PurposeExpresses GFP-LC3-RFP in mammalian cells to measure autophagic flux without any drug resistance.DepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseRetroviralTagsEGFP and mRFP1ExpressionMammalianAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau
Plasmid#46904Purposeexpresses EGFP tagged Tau in mammalian cellsDepositorInsertMAPT (MAPT Human)
TagsEGFPExpressionMammalianMutationThis WT htau construct contains human four-repeat…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-LC3B Q116P G120
Plasmid#129289PurposeExpresses 3xFLAG-tagged deconjugation-resistant LC3B in mammalian cellsDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
Tags3xFLAGExpressionMammalianMutationChanged Glutamine 116 to Proline. Deleted amino a…PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSRG11 (eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR)
Plasmid#245121PurposeOptimized SunTag antibody for expression in C. elegans. Useful for visualization of translation of GCN4 encoding mRNAs or for visualization of GCN4-tagged proteinsDepositorInsertseft-3p
scFv (GLO)
GFP (GLO)
tbb-2 3'UTR
left recombination arm MosSCI ttTi5605
right recombination arm MosSCI ttTi5605
ExpressionBacterial and WormAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts
Plasmid#195065PurposeExpresses FLAG-tagged Drosophila mts proteinDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 LC3B Q116P G120
Plasmid#129291PurposeGateway entry clone encoding human deconjugation-resistant LC3BDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseGateway entry vector / entry cloneMutationChanged Glutamine 116 to Proline. Deleted amino a…Available SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau AP
Plasmid#46905Purposeexpresses EGFP tagged Tau AP in mammalian cellsDepositorInsertTau AP (MAPT Human)
TagsEGFPExpressionMammalianMutationall 14 S/P or T/P amino acid residues (T111, T153…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts D85N
Plasmid#208403PurposeExpresses FLAG-tagged Drosophila mts protein with D85N mutationDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts H59Q
Plasmid#208402PurposeExpresses FLAG-tagged Drosophila mts protein with H59Q mutationDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts H241A
Plasmid#208404PurposeExpresses FLAG-tagged Drosophila mts protein with H241A mutationDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B Q116P G120
Plasmid#129290PurposeExpresses GFP-tagged deconjugation-resistant LC3B in mammalian cellsDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsGFPExpressionMammalianMutationChanged Glutamine 116 to Proline. Deleted amino a…PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -