We narrowed to 24,352 results for: CRISPR
-
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMB63
Plasmid#47945PurposeExpresses C. elegans optimized Cas9 from the eef-1A.1 (eft-3) promoterDepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLS, and egl-13 NLSExpressionWormPromotereef-1A.1 (eft-3)Available SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_Puro
Plasmid#167871PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pADH139
Plasmid#90987PurposeNAT-marked "empty" gRNA construct for use in gRNA expression cassette stitching PCR; use with pADH110 to generate target-specific part 2 of 2 for C.mal LEUpOUT CRISPR system.DepositorInsertgRNA conserved, C, mal LEU2 2 of 2
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA AAVS1
Plasmid#128119PurposeCo-expresses sgRNA AAVS1, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA AAVS1 + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_Hygro
Plasmid#167883PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_KanR neo
Plasmid#167861PurposePiggyBac compatible plasmid expressing spCas9DepositorInsertCas9
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF:iCas9
Plasmid#138267PurposeExpression of mTN3-GGS6-dCas9 (iCas9) in human.DepositorInsertmTN3-GGS6-dCas9
UseCRISPRExpressionMammalianMutationCas9-D10A, H840APromoterEf1aAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_Puro
Plasmid#167887PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M7NS_AmpR
Plasmid#119157PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-WingGFP-tan
Plasmid#83473PurposeEGFP selectable marker for use in two-stage CRISPR-mediated allele replacement strategies in Drosophila. D. americana tan homology arms can be replaced with locus of choice.DepositorInsertWingGFP-tan
UseCRISPRExpressionBacterial and InsectPromoterHsp70 and enhancer from D. melanogaster yellow ge…Available SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_EYFP
Plasmid#167882PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A_FokI-1x4
Plasmid#63604PurposeExpresses FokI-dCas9 and gRNADepositorInsertFokI-dCas9
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only