We narrowed to 2,515 results for: gcg
-
Plasmid#87200PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting 5' UTR of HTTDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pU6-pegRNA-LRRK2-G2019S-3a
Plasmid#180432PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001162484)
Plasmid#78011Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001148194)
Plasmid#77035Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgSHMT1-G3
Plasmid#83903Purposestable knockoutDepositorInsertSerine hydroxymethyltransferase 1 (SHMT1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_wt
Plasmid#156182PurposeDox-inducible expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AURKB gRNA (BRDN0001146837)
Plasmid#77619Purpose3rd generation lentiviral gRNA plasmid targeting human AURKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #1
Plasmid#61515Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgcggcagctcctagctcagc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid2#2/Cre
Plasmid#173576PurposeExpresses a Arid2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid2 (Arid2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgCh2-2
Plasmid#125775Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgCh2-2
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162355)
Plasmid#76311Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_N82A
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only