We narrowed to 11,061 results for: AGA
-
Plasmid#215087PurposeExpresses FFSS-Cyclin D1 in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-FFSS-Cyclin D1 (T286A)
Plasmid#215147PurposeExpresses FFSS-Cyclin D1 (T286A) in mammalian cells from an inducible lentiviral vector.DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagsFFSS (FLAG-FLAG-STREP-STREP)ExpressionMammalianMutationWith T286A mutation.PromoterTRE3GSAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX
Plasmid#124258PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CCND1(T286A)
Plasmid#172647PurposeExpresses 2xFLAG-2xSTREP-tagged cyclin D1(T286A) in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND2-Puro
Plasmid#172626PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D2 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3a
Plasmid#180432PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6Available SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1(T286A)-IRES-mCherry
Plasmid#172639PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1(T286A) and mCherry in mammalian cellsDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTags2xFLAG-2xSTREPExpressionMammalianMutationThr286AlaPromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APTX
Plasmid#215128PurposeExpresses mCherry-APTX in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
p21-mCerulean-NeoR
Plasmid#215080PurposeExpresses p21-mCerulean in mammalian cells.DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-2xFLAG-mAID-AMBRA1 HDR donor template
Plasmid#172609PurposeDonor plasmid containing the HDR template for the in-frame, N-terminal 2xFLAG-mAID tagging of AMBRA1 geneDepositorInsert2xFLAG-mAID-AMBRA1 (AMBRA1 Synthetic, Human)
UseCRISPR; Human targetingAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXs-ms-c-Myc-L420P
Plasmid#50776Purposeretroviral expression of mouse c-Myc L420P mutantDepositorUseRetroviralExpressionMammalianMutationL420P (does not bind to Max)Available SinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBABE-2xFLAG-2xSTREP-CCND2-Puro
Plasmid#172628PurposeRetroviral vector for the constitutive, near-physiological expression of 2xFLAG-2xSTREP-tagged cyclin D2 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7 (R310H)
Plasmid#171849PurposepcDNA3-FLAG_FBXL7 (R310H)DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
TagsFlagExpressionMammalianMutationchanged Arginine 310 to HistidineAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE-2xFLAG-2xSTREP-CCND3-Puro
Plasmid#172622PurposeRetroviral vector for the constitutive, near-physiological expression of 2xFLAG-2xSTREP-tagged cyclin D3 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1(P287S)-IRES-mCherry
Plasmid#172635PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1(P287S) and mCherry in mammalian cellsDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTags2xFLAG-2xSTREPExpressionMammalianMutationPro287SerPromoterCMVAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND2(T280A)-Puro
Plasmid#172625PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D2(T280A) and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only