We narrowed to 16,486 results for: form
-
Plasmid#160067Purpose3-point mutation negative control for CBSH3+ shRNA-1 targeting collybistin isoforms with SH3+ domain (plasmid 160066)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGGcTGaTTaCAACAAGGATTG (mutations shown in lower c…Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b6-Poly(A)-NeoR
Plasmid#65552PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b6 cDNA into a MIN-tagged locus using Neomycin selectionDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 6Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i1-TEV-Strep
Plasmid#174500Purposebacterial co-expression of human SEPT7 and of human SEPT9_i1DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-NTID194-GSQ-PMLivaWT-P2A-BLAST
Plasmid#208038PurposeEnables constitutive expression of N-terminal Split-TurboID-fused PML (isoform IVa; WT); to perform SUMO-ID; selection with blasticidinDepositorInsertPML (isoform IVa) (PML Human)
UseLentiviralTagsFLAG, N-terminal Split-TurboIDPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-PGC-1alpha1
Plasmid#45501DepositorInsertPGC-1alpha Isoform1 (Ppargc1a Mouse)
Tags6xHis and FlagExpressionMammalianMutationQ339K relative to NM_008904Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 CMV 3xFG eIF4G1
Plasmid#158775PurposepcDNA5 transfection plasmid for the exogenous expression of N-terminal 3xFlag-tagged eIF4G1 isoform lacking the microexon.DepositorInserteIF4G1
Tags3xFlagExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 CMV 3xFG eIF4G1 +MIC
Plasmid#158776PurposepcDNA5 transfection plasmid for the exogenous expression of N-terminal 3xFlag-tagged eIF4G1 isoform including the microexon.DepositorInserteIF4G1 (with microexon)
Tags3xFlagExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i5-TEV-Strep
Plasmid#174502Purposebacterial co-expression of human SEPT7 and of human SEPT9_i5DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i3-TEV-Strep
Plasmid#174501Purposebacterial co-expression of human SEPT7 and of human SEPT9_i3DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FlpE-bGHpA
Plasmid#50364PurposeCan be used to generate AAV virus that will express FlpE recombinse gene in neurons from the synapsin promoterDepositorInsertFlpE recombinase gene
UseAAVPromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 SIRT1-deltaExon2
Plasmid#105671PurposeMammalian expression construct of mouse SIRT1 short isoform (lacking Exon2)DepositorInsertSIRT1 (Sirt1 Mouse)
ExpressionMammalianMutationSynonymous base changes not affecting the protein…PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-PGC-1alpha2
Plasmid#45502DepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hPEN2 D90A
Plasmid#183641PurposeLentiviral expression of a PEN2 mutant losing its binding affinity to metformin at the C-terminus (lysosome lumen).DepositorInsertPEN2 (PSENEN Human)
UseLentiviralTagsHAMutationresidues 90 of PEN2 mutated to alaninePromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hPEN2 2A
Plasmid#183640PurposeLentiviral expression of a PEN2 mutant losing its binding affinity to metformin at the N-terminus (cytosolic face).DepositorInsertPEN2 (PSENEN Human)
UseLentiviralTagsHAMutationresidues 35 and 40 of PEN2 mutated to alaninePromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/Strep-HA-ZAK beta
Plasmid#141195PurposeExpresses Strep-HA-ZAK beta in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
Plasmid#162877PurposeExpression in mammalian cells of Plekstrin-homology domain of Phospholipase C delta tagged with mEos2 to perform sptPALMDepositorInsertpleckstrin homology domain of PLCδ1 (phospholipase C-δ1) (PLCD1 Human)
TagsmEos2ExpressionMammalianMutationInsert consists of AA1-170Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 GBP (GBP-mEos2)
Plasmid#162876PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos2
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PET.SUMO eIF4G1 1-200
Plasmid#158791PurposeBacterial expression vector for the expression of N-terminal 6xHIS-SUMO-tagged codon optimized eIF4G1 amino acids 1-200 isoform lacking the microexon.DepositorInserteIF4G1 (codon optimized)
Tags6xHIS and SUMOExpressionBacterialMutationamino acids 1-200PromoterT7Available SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only