We narrowed to 14,605 results for: Ung;
-
Plasmid#140374PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 4BP dowsntream from the promoterDepositorInsertT7-4BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL705
Plasmid#140375PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 5BP dowsntream from the promoterDepositorInsertT7-5BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Desmin/pAS2-1
Plasmid#97407PurposeDesmin (aa 30 – 103) in DNA-binding domain (BD) vector, used for yeast-two hybridDepositorInsertDesmin (DES Human)
ExpressionYeastAvailable SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S186D
Plasmid#16239DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTS585P-myc
Plasmid#107498PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation S585P conferring gain of function phenotypeDepositorAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S166D
Plasmid#16238DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTG56A -myc
Plasmid#107459PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation G56A conferring wildtype phenotypeDepositorAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-CDS
Plasmid#136053PurposeREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC
Plasmid#140200PurposeCloning vector for LbCas12a crRNAs ( Step 1 of the 2-step cloning alternative). Full PgpdA sequence is reconstituted when amplifying the expression cassette for cloning in a fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsdLbCas12a crRNA scaffoldPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFGL1170R
Plasmid#116896PurposehH1:mCherry (nuclear marker)DepositorInsertshH1
mCherry
hH1 downstream region
UseFungal expression (in magnaporthe oryzae)Mutationno start codon, no stop codon and without start c…Promoterpromoter lessAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHL 651
Plasmid#53016PurposeLacIq + PCon::RBS (st3) tetR::T1 terminator + p15a + CamR. Backbone from pZA32MCS1 (Lutz and Bujard, 1997).DepositorInsertsLacIq
tetR
UseSynthetic BiologyTagsRBS(st3) and T1 terminatorExpressionBacterialPromoterpConAvailable SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHL 1277
Plasmid#53017PurposeAmpR + PLtetO-1::RBS (st7) gfp::T1 terminator + PLlacO-1::RBS (st7) mCherry::Asp terminator + ColE1DepositorInsertsGFP
mCherry
UseSynthetic BiologyTagsRBS(st7)ExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-BSA4-G-S10
Plasmid#127828PurposeProduction of recombinant human ribosomal protein S10DepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMYA5/pACT2
Plasmid#97208PurposeCMYA5 (aa 4039 – 4069) in a GAL4 AD vector, used for yeast-two hybridDepositorInsertCMYA5 (CMYA5 Human)
ExpressionYeastAvailable SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPC myc-mRAP1 I312R
Plasmid#73137PurposeExpression of myc-tagged mRAP1 with single point mutatoin I312RDepositorInsertRap1 (Terf2ip Mouse)
TagsmycExpressionMammalianMutationisoleucine changed to an arginine at amino acid 3…Available SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHL 1278
Plasmid#53018PurposeAmpR + PLtetO-1::RBS (st7) mCherry::T1 terminator + PLlacO-1::RBS (st7) gfp::Asp terminator + ColE1DepositorInsertsmCherry
GFP
UseSynthetic BiologyTagsRBS(st7)ExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only