We narrowed to 4,689 results for: crispr c plasmids
-
Plasmid#234053PurposePlasmid for AIcrVIA2 expression during phage assayDepositorInsertAIcrVIA2
Tags6XHisExpressionBacterialPromoteraraBAD promoterAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBAD_AIcrVIA1
Plasmid#234052PurposePlasmid for AIcrVIA1 expression during phage assayDepositorInsertAIcrVIA1
Tags6XHisExpressionBacterialPromoteraraBAD promoterAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX601‐mhCMV‐miniABEmax‐N3‐ E53ogRNA
Plasmid#187064PurposeNpu Split N-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutationDepositorInsertminiABEmax-Npu
UseAAV and CRISPRExpressionMammalianPromotermhCMVAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459_GINS4_gRNA
Plasmid#232734PurposeGenerates GINS4 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHD-sfGFP-ScarlessDsRed-GMR-eya(shRNA)
Plasmid#240228PurposeParental donor plasmid for scarless sfGFP-fusion knock-in fly lines. Red fluorescent fly eye marker to select for knock-in events, small fly eye marker to select against backbone integration.DepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry
Plasmid#208834PurposeControl plasmid expresses mCherry under the hSyn1 promoter with sgRNAs against LacZ and GFPDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-mCherry-P2A-Cre-WPRE
Plasmid#107312PurposeEncoding hSyn-mCherry-CreDepositorHas ServiceAAV1InserthSyn-mCherry-P2A-Cre-WPRE
UseAAVExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Plasmid#107311PurposeEncoding scFv-p65-HSF1 driven by EF1α promoterDepositorInsertEF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
UseLentiviralExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
Plasmid#107313PurposeEncoding aCamkII-mCherry-CreDepositorInsertaCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
UseAAVExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMLS262
Plasmid#73718PurposeC. elegans Pan-neuronal 2xNLS-FLP-D5 expression vectorDepositorInsertPsnt-1::2xNLS-FLP-D5
ExpressionWormMutationG5DPromoterPsnt-1Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
KG#908
Plasmid#110914PurposeExpresses the plant proteins TIR1 (necessary for Auxin-Inducible Degradation) pan-neuronally in C. elegansDepositorInsertsrab-3 promoter
TIR1 cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTSTEP
Plasmid#72334PurposeTissue-specifically swappable (C-terminal TagRFPT-to-EGP) genome tagging plasmid with Golic+ selection cassette for fully transgenic gene targeting (Drosophila melanogaster)DepositorInsertRRS-TagRFPT-p10-[Golic+] RRS-EGFP
UseCRISPRExpressionInsectAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-ODN-hsRPL3-CterTwStrep
Plasmid#208644Purposefor long single strand DNA donnor preparation for Twin Strep tag knock-in at C ter of human RPL3. Digest with nt.BspQI and nb.BsrDI to get ssDNA. This plasmid will cause re-edit and fail knock-in.DepositorInsertTwin Strep tag with RPL3 genome HomoArm (RPL3 Human, Synthetic)
UseCRISPR; Ssdna donnor preparationTagsTwin StrepAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
Plasmid#67974PurposeCRISPR gRNA expression vector with an improved scaffold and puro/BFP markersDepositorInsertU6gRNA cassette, PGKpuro2ABFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDY0663 ACTB atgRNA with v2 scaffold
Plasmid#179108PurposeACTB N-term PBS 13 RT 29 Bxb1 AttB 46 atgRNA with v2 scaffoldDepositorInsertACTB N-term PBS 13 RT 29 AttB 46 atgRNA with v2 scaffold
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMB2_sgRNA_1
Plasmid#155092Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMB2 (core essential gene)DepositorInsertPSMB2_sgRNA_1 (PSMB2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria3
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)
Plasmid#129027Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rab11 single guide RNA
Plasmid#229683Purposeguide RNA for Rab11 tagging at the N-terminus in pX459DepositorInsertRab11 guide (RAB11A Human)
UseCRISPRAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only