We narrowed to 4,848 results for: pAAV
-
Plasmid#185718PurposeAAV expression of GFP and human α-Synuclein with S129A mutation from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVTagsExpressionMutationChanged Ser 129 to AlaPromoterhSynAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM4D(Gi)-mCherry-WPRE-pA(Short)
Plasmid#183704PurposeAAV to express hM4D(Gi)-mCherry fusion protein. Viral genome 3' UTR modified to bring the viral genome below the optimal AAV packaging limitDepositorInserthM4D(Gi)
UseAAVTagsmCherryExpressionMutationPromoterCaMKIIaAvailable sinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry-WPRE-pA(Short)
Plasmid#183705PurposeAAV to express hM3D(Gq)-mCherry fusion protein. Viral genome 3' UTR modified to bring the viral genome below the optimal AAV packaging limitDepositorInserthM3D(Gq)
UseAAVTagsmCherryExpressionMutationPromoterCaMKIIaAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-503-WPRE
Plasmid#174133PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-503 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-427-WPRE
Plasmid#174135PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-427 fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Mouse)
UseAAVTags3xFLAG and mCherryExpressionMutationOnly contains the sequences coding for amino acid…PromoterhSynAvailable sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TREtight-H2b-emiRFP670-P2A-TEVP
Plasmid#174379PurposeAAV virus for expressing TEVP and H2b-emiRFP670DepositorInsertTEVP
UseAAVTagsExpressionMutationPromoterAvailable sinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-HA-CB2SH3(-)-IRES-mCitrine
Plasmid#160069PurposeConditionally overexpress collybistin (CB2SH3-) and mCitrineDepositorInsertARHGEF9 (Arhgef9 Rat)
UseAAVTagsHA- in CB2SH3ExpressionMutationPromoterhuman Synapsin promoterAvailable sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6 and hU6Available sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6 and hU6Available sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPRE
Plasmid#120394PurposepAAV plasmid expressing Diras2 shRNA2 under the U6 promoter and mCherry.3XFLAG under the hSyn promoterDepositorInsertDiras2 shRNA (Diras2 Mouse)
UseAAV and RNAiTagsmCherry.3XFLAGExpressionMutationPromoterU6Available sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-NMBR-eLOV-TEVcs-FLAG-GAL4-V5
Plasmid#104843Purposeb2AR-SPARK TF componentDepositorInsertNMBR-eLOV-TEVcs-FLAG-GAL4-V5
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable sinceJan. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVf-EnhCB-lacZnls mir-122 1xBS
Plasmid#35643DepositorInsert1 miR-122 target site
UseAAVTagsExpressionMutationPromoterCBAvailable sinceApril 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X
Plasmid#192151PurposeT cell CRISPR AAV-SB vectorDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationNAPromoterAvailable sinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP20027 - pAAV-AiE2182m_3xC2-minBG-iCre(R297T)-BGHpA
Plasmid#220735PurposeAiE2182m_3xC2 is an optimized enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsInsertiCre(R297T)
UseAAVTagsExpressionMutationPromoterminBGAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1894 - pAAV-AiE2582m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214573PurposeAiE2582m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsInsertSYFP2
UseAAVTagsExpressionMutationPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP2105 - pAAV-AiE2638m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230551PurposeAiE2638m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsInsertSYFP2
UseAAVTagsExpressionMutationPromoterminBGAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-FLEX-NEPLDCV-P2A-mRUBY3-WPRE
Plasmid#207664PurposeNeuropeptide degradationDepositorInsertNEP (MME Human)
UseAAV and Cre/LoxTagsmRUBY3ExpressionMutationAddition of signaling peptide (POMC) on the N-ter…PromoterhSynapsinAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
Plasmid#212829PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the human genome.DepositorInsertZIM3-KRAB-dCas9-P2A-mCherry
UseTagsHA-tag and ZIM3-KRABExpressionBacterial and MammalianMutationPromoterCAG, TetOnAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only