We narrowed to 9,048 results for: sgRNA
-
Plasmid#139398PurposeBile Acid inducible sgRNA-6 with PM6 driving Nanoluc expression (NOT Gate 6), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-6 with PM6 driving Nanoluc expression (NOT Gate 6)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT494
Plasmid#139399PurposeBile Acid inducible sgRNA-7 with PM7 driving Nanoluc expression (NOT Gate 7), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-7 with PM7 driving Nanoluc expression (NOT Gate 7)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT451
Plasmid#139391PurposeBile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOT Gate 4), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOT Gate 4)
UseSynthetic BiologyPromoterBA inducible promotersAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT455
Plasmid#139392PurposeaTC and Bile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOR Gate), AmpR, ErmRDepositorInsertaTC and Bile Acid inducible sgRNA-4 with PM4 driving Nanoluc expression (NOR Gate)
UseSynthetic BiologyPromoteraTC and BA inducible promotersAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti ccdB sgRNA Hyg sfGFP
Plasmid#235048PurposeLentiviral sgRNA expression vector with hygromycin and superfolder GFP. Also contains ccdB cassette for library cloning.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 sgZER1-1
Plasmid#191549PurposeExpression of spCas9 and sgRNA targetting ZER1DepositorInsertspCas9 (ZER1 Human)
UseLentiviralAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 sgZER1-2
Plasmid#191550PurposeExpression of spCas9 and sgRNA targetting ZER1DepositorInsertspCas9 (ZER1 Human)
UseLentiviralAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#1
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#2
Plasmid#208388PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#2 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-SID4X-pU6-sgRNA
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL6 sgRNA(MS2)-MS2-hA3a D131E
Plasmid#112132Purposeempty sgRNA cloning vector with MS2-humanA3a D131EDepositorInserthuman Apobec3a D131E mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationD131E mutant in hA3aPromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-PGK-hCD2
Plasmid#224294PurposeExpresses sgRNA from U6 promoter and human CD2 under PGKDepositorInsertU6 sgRNA cassette with CD2 under PGK promoter (CD2 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6/PGKAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-GFP-TRIM28
Plasmid#185010PurposeEncodes gRNA for mouse TRIM28 along with Cas9 with 2A-EGFPDepositorInsertTRIM28 sgRNA (Trim28 Mouse)
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459_MCM2_sgRNA
Plasmid#232730PurposeGenerates MCM2 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only