We narrowed to 11,061 results for: aga
-
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SF3B1-NTerm
Plasmid#97425PurposeExpresses human SF3B1 (AA 1-500) with N-term GST tag for inducible expression in E.coliDepositorInsertSF3B1-N-term (AA1-500)
TagsGSTExpressionBacterialMutationSilent mutation at nt876, aa289 (AGG to AGA)PromotertacAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FHp5pUP95C3,5SGW (E5)
Plasmid#74035Purposelentiviral expression of Psd95 shRNA and Psd95-C3,5S-EGFP fusionDepositorInsertPsd95
UseLentiviral and RNAiExpressionMammalianMutationPCR: C3,5S (tct aga cca cca tgg act Ctc tAt CGa t…PromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-42_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211682PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-42 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pED7x26
Plasmid#134813PurposeStringent phage propagation reporter containing pIII-16-29-34-TAGADepositorInsertpIII 16-TAGA 29-TAGA 34-TAGA
UseSynthetic BiologyExpressionBacterialMutation16-TAGA 29-TAGA 34-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb-IRES2-EGFP
Plasmid#204354PurposeExpresses wild-type PDGFRb gene.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb-HA
Plasmid#204350PurposeExpresses wild-type PDGFRb gene. Used for DNA delivery using Adeno-associated Virus.DepositorAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb559-562del-IRES2-EGFP
Plasmid#204355PurposeExpresses a mutant PDGFRb gene (559-562 deletion).DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Mutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfPENK-0.9k-Venus-WPRE
Plasmid#156401PurposeExpresses Venus under PENK gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSST-0.3k-Venus-WPRE
Plasmid#156393PurposeExpresses Venus under SST gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only