We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#106964Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralExpressionMammalianPromoterEFSAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-VPR-eGFP
Plasmid#241307Purpose3rd generation lenti vector encoding dCas9 (s. Pyogenes) fused with the VP64-p65-Rta(VPR) and a 2A GFP fluorescence markerDepositorInserteGFP
UseLentiviralAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-VPR-H2B-GFP (CRISPRa)
Plasmid#175571PurposeInactivated Cas9 (dCas9) fusion to VPR for the purpose of targeted activationDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-VPR-H2B-mCherry (CRISPRa)
Plasmid#175572PurposeInactivated Cas9 (dCas9) fusion to VPR for the purpose of targeted activationDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9 sgRNA vector
Plasmid#68463PurposeCas9 sgRNA vector for cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-idCas9-vpr
Plasmid#89985Purposeinducible CRISPR-ON system for controllable gene activation; this plasmid is used to insert dCas9-VPR casette in one allele of AAVS1 locusDepositorInsertdCas9-VPR
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_T2A_mCherry sg1-sg2
Plasmid#192479PurposeAll-in-one plasmid containing both guides for cutting BFP region in DSB Spectrum V1DepositorInsertSpCas9
TagsT2A mCherryExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462)
Plasmid#48141PurposeNOTE: A new version of this plasmid is now available. See Addgene plasmid 62987DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KRAB-MeCP2_KanR neo
Plasmid#167901PurposePiggyBac compatible plasmid expressing dCas9-KRAB-MeCP2 expression plasmidDepositorInsertdCas9-KRAB-MeCP2
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVneo
Plasmid#134982PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRExpressionBacterialPromoterS. pyogenes Cas9 native promoterAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-dCas9-ZIM3-KRAB-BFP
Plasmid#196712PurposeCRISPR-inhibition. dCas9-KRAB(ZIM3) with TagBFP for sorting. Improved KRAB domain from ZIM3DepositorInsertdCas9-KRAB(ZIM3)-T2A-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSMutationD10A, N863APromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only