We narrowed to 8,573 results for: reporter
-
Plasmid#138574PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only
-
nuc-yHS1-M7A
Plasmid#159167PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A
TagsSV40 NLSExpressionYeastMutationMutated Met 7 of the cyt b562 module of nuc-yHS1 …PromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
p1.1-Tr2-eGFP
Plasmid#162782PurposeFluorescent reporter for protein expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFAB3893
Plasmid#47844PurposeBIOFAB RFP reporter plasmid for measuring promoter 13 + BCD1 efficiency.DepositorInsertpromoter 13 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUASM1:mScarletNLS-SV40pA
Plasmid#155124PurposeTol2 vector containing QUASM1 reporter element upstream of mScarlet-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUASM1:mScarletNLS
UseZebrafish expressionPromoterQUASM1-E1bAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282kB mut-LUC
Plasmid#46867Purposemurine 24p3 minimal promoter with NF-kB mutation as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationNF- kB site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282C/EBP mut-LUC
Plasmid#46868Purposemurine 24p3 minimal promoter with C/EBP mutation k as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationCEBP site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1Tt
Plasmid#44509DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1GZmbh
Plasmid#44522DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFL-SV40-Rac1 5'-UTR
Plasmid#115354Purposefirefly luciferase (Fluc) reporter containing the 5’-UTR of Rac1DepositorAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSL011_AAVS1-puro-9xTetO-pEF-H2B-mCitrine-pRSV-H2B-mCherry
Plasmid#179428PurposeDual fluorescent reporter construct with no spacer, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertTRE-cit-(nospacer)-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer5
Plasmid#138577PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17893352_17894696DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIS1-wt RhoA 3'UTR
Plasmid#26089DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFAB3725
Plasmid#47837PurposeBIOFAB RFP reporter plasmid for measuring promoter 6 + BCD1 efficiency.DepositorInsertpromoter 6 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3869
Plasmid#47842PurposeBIOFAB RFP reporter plasmid for measuring promoter 11 + BCD1 efficiency.DepositorInsertpromoter 11 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3992
Plasmid#47823PurposeBIOFAB RFP reporter plasmid for measuring promoter 14 + BCD16 efficiency.DepositorInsertpromoter 14 and BCD16
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-JNKsub(TA)DD-YPet-NES
Plasmid#84634PurposeEncodes negative-control C-terminal (substrate) fragment of bimolecular JNK activity reporter (bimJNKAR); cytosol targeted; use in conjunction with pcDNA3-Cerulean-FHA1-NESDepositorInsertJNKsub(TA)DD-YPet-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRL-pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40
Plasmid#186967PurposeLentiviral vector encoding DNMT3A recruiter for methylation reporter (pEF-H2B-mCherry-T2A-rTetR-DNMT3L-SV40) for expression in mammalian cells.DepositorInsertDNMT3L (DNMT3L Human, Synthetic)
UseLentiviralTagsrTetR fusionExpressionMammalianPromoterEF-1alpha promoterAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1GZmbh
Plasmid#44516DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
DF-UAS-spa-GCaMP6f
Plasmid#67568PurposeZebrafish expression of a photoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6f
UseZebrafish transgenesis (see :a spinal opsin contr…TagsHIS-tagMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFAB1935
Plasmid#47860PurposeBIOFAB reporter plasmid for measuring his_T_min_linker_crp_T_min termination efficiencyDepositorInserthis_T_min_linker_crp_T_min double terminator
UseSynthetic BiologyExpressionBacterialMutationconcatenate of his_min and crp_minPromoterpLTetO15Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEMS2131
Plasmid#111895PurposessAAV genome with MCS for inserting MiniP promoter to drive an emerald GFP (EmGFP) reporter. Contains WPREDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFL-SV40-GNB2 5'-UTR
Plasmid#115355Purposefirefly luciferase (Fluc) reporter containing the 5’-UTR of GNB2DepositorAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pluc-miR148a-148aT
Plasmid#65053PurposeReporter plasmid to detect miR148/152 family expressionDepositorInsertEngineered target sites miR-148a-3p (MIR148A Mouse, Human)
UseLuciferaseExpressionMammalianPromoterSV40Available SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ERKsub(TA)DD-Venus-NES
Plasmid#84631PurposeEncodes negative-control C-terminal (substrate) fragment of bimolecular ERK activity reporter (bimEKAR); cytosol targetedDepositorInsertERKsub(TA)DD-Venus-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianMutationMutated target Thr residue to Ala.PromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDK4-luciferase active (880)
Plasmid#86657PurposeLuciferase reporter containing CDK4 promoterDepositorInsertCDK4 promoter (CDK4 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation867 base pairs including up to coding nucleotide …PromoterCDK5Available SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFAB3913
Plasmid#47816PurposeBIOFAB RFP reporter plasmid for measuring promoter 14 + BCD9 efficiency.DepositorInsertpromoter 14 and BCD9
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-D
Plasmid#64516PurposeAS-30D hepatoma hexokinase II 1.0 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase II promoterAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Ywhag-3'UTR-MRE-3 MUT
Plasmid#61792PurposeLuciferase reporter containing the 3'UTR of mouse Ywhag with MRE-3 mutatedDepositorInsertmouse Ywhag 3'UTR with miR-200c MRE-3 mutated
UseLuciferaseMutationmiR-200c MRE-3 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
NG1301 pCI-TPI-4MS2-SMG5(short)-4H
Plasmid#65806PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4 MS2 stem loops, SMG5 3'UTR shortened versi…ExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-YNL
Plasmid#65711PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-YNL)DepositorInsert7xTcf, minCMV, 3xNLS, YNL
UseLuciferase; Tol2 systemAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.2
Plasmid#85531PurposeInducible expression of guide RNA (huMcl-1.2) with fluorescent GFP reporterDepositorInserthu Mcl-1.2
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
CDk4-luciferase fragment A
Plasmid#86658PurposeLuciferase reporter containing CDK4 promoterDepositorInsertCDK4 promoter (CDK4 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationgenerated by cleavage at the NcoI site from 880 (…PromoterCDK6Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom27bp-pGL4.10Luc
Plasmid#60876PurposeLuc reporter driven by 27 bp of the CIP2A promoterDepositorInsert27 bp promoter fragment of Cancerous Inhibitor of PP2A (CIP2A Human)
UseLuciferase; PromoterlessAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom285bp-pGL4.10Luc
Plasmid#60873PurposeLuc reporter driven by 285 bp of the CIP2A promoterDepositorInsert285 bp promoter fragment of Cancerous Inhibitor of PP2A2 (CIP2A Human)
UseLuciferase; PromoterlessAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFAB3665
Plasmid#47832PurposeBIOFAB RFP reporter plasmid for measuring promoter 1 + BCD1 efficiency.DepositorInsertpromoter 1 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3701
Plasmid#47835PurposeBIOFAB RFP reporter plasmid for measuring promoter 4 + BCD1 efficiency.DepositorInsertpromoter 4 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3845
Plasmid#47840PurposeBIOFAB RFP reporter plasmid for measuring promoter 9 + BCD1 efficiency.DepositorInsertpromoter 9 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3857
Plasmid#47841PurposeBIOFAB RFP reporter plasmid for measuring promoter 10 + BCD1 efficiency.DepositorInsertpromoter 10 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB1902
Plasmid#47858PurposeBIOFAB reporter plasmid for measuring M13_central_T_linker_rrnD_T1 termination efficiencyDepositorInsertM13_central_T_linker_rrnD_T1 double terminator
UseSynthetic BiologyExpressionBacterialMutationconcatenate of M13 central and rrnDPromoterpLTetO13Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3997
Plasmid#47828PurposeBIOFAB RFP reporter plasmid for measuring promoter 14 + BCD21 efficiency.DepositorInsertpromoter 14 and BCD21
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB3912
Plasmid#47815PurposeBIOFAB RFP reporter plasmid for measuring promoter 14 + BCD8 efficiency.DepositorInsertpromoter 14 and BCD8
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNarsenic_noProm
Plasmid#247321PurposeControl plasmid for pNarsenic lacking the ArsR-regulated promoter upstream of the reporter geneDepositorInsertsfdeR
mkate2
Arsenical resistance operon repressor
UseSynthetic BiologyPromoterNone, P_fdeA, and P_fdeRAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVSr-GhOMT1
Plasmid#234932PurposeThis virus-induced gene silencing (VIGS) reporter vector is used to evaluate the silencing of GhOMT1 geneDepositorInsertPartial coding region sequence of GhOMT1
ExpressionPlantAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only