We narrowed to 4,337 results for: U6 gRNA
-
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M3_3-pTRNA-scf 2.1 (GB2075)
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiUniversal-Puro
Plasmid#127749PurposeLentiviral plasmid for expressing any U6 driven transcripts (sgRNAs, crRNAs, shRNAs and etc...)DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF204
Plasmid#121656PurposeU6-sgRNA EFS-Cas9-wt-P2A-PuroDepositorInsertCas9
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF704
Plasmid#121658PurposeU6-sgRNA EFS-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF712
Plasmid#121663PurposeU6-sgRNA EF1a-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFD5_w
Plasmid#112645PurposeUbiquitous expression of one or multiple sgRNAs in Drosophila. Selection marker: Mini-white.DepositorInsertU6:3-tRNA-sgRNA expression cassette
UseTagsExpressionInsectMutationPromoterAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterEF1Alpha and U6Available sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only