We narrowed to 17,967 results for: jun
-
Plasmid#234637PurposepET-28a(+) based plasmid for expression of H16_B1148 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pSLB029
Plasmid#234638PurposepET-28a(+) based plasmid for expression of H16_B1264 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB030
Plasmid#234639PurposepET-28a(+) based plasmid for expression of H16_B1335 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB026
Plasmid#234635PurposepET-28a(+) based plasmid for expression of H16_A3514 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mNeonGreen-G418
Plasmid#236484PurposePlasmid for deleting or C-terminally tagging endogenous genes with mNeonGreen and selection on G418.DepositorInsertmNeonGreen
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Hyg
Plasmid#236486PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Hyg.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-Nat
Plasmid#236485PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on Nat.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mStayGold-G418
Plasmid#236487PurposePlasmid for deleting or C-terminally tagging endogenous genes with mStayGold and selection on G418.DepositorInsertmStayGold
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Nat
Plasmid#236488PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Nat.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-Hyg
Plasmid#236480PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on Hyg.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-G418
Plasmid#236490PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on G418.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mScarlet-Nat
Plasmid#236491PurposePlasmid for deleting or C-terminally tagging endogenous genes with mScarlet and selection on Nat.DepositorInsertmScarlet
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Hyg
Plasmid#236489PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Hyg.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-Dendra2-G418
Plasmid#236496PurposePlasmid for deleting or C-terminally tagging endogenous genes with Dendra2 and selection on G418.DepositorInsertDendra2
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-GFP-Nat
Plasmid#236476PurposePlasmid for deleting or C-terminally tagging endogenous genes with GFP and selection on Nat.DepositorInsertGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-Dendra2-Hyg
Plasmid#236495PurposePlasmid for deleting or C-terminally tagging endogenous genes with Dendra2 and selection on Hyg.DepositorInsertDendra2
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mNeonGreen-Hyg
Plasmid#236483PurposePlasmid for deleting or C-terminally tagging endogenous genes with mNeonGreen and selection on Hyg.DepositorInsertmNeonGreen
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mScarlet-G418
Plasmid#236493PurposePlasmid for deleting or C-terminally tagging endogenous genes with mScarlet and selection on G418.DepositorInsertmScarlet
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mScarlet-Hyg
Plasmid#236492PurposePlasmid for deleting or C-terminally tagging endogenous genes with mScarlet and selection on Hyg.DepositorInsertmScarlet
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only