We narrowed to 3,157 results for: bad
-
Plasmid#223511PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialMutationY306A; Y384FPromoteraraBAD, rrnB, and glnS and proKAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pEvol-MjaYRS
Plasmid#153557PurposeAmber suppression for incorporating 3-aminotyrosine to proteins in E. coliDepositorInsertsMJaYRS (first copy)
MJaYRS (second copy)
amber suppression tRNA under proK promoter
ExpressionBacterialPromoterglnS and pBADAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSAM_AraC
Plasmid#91569PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Arabinose promoter expresses transposase. Ampicillin resistance on backbone.DepositorInsertAraC/PBAD
ExpressionBacterialAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Km
Plasmid#207999PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-AckRS
Plasmid#137976Purposesequence optimized N‐acetyl lysyl‐tRNA synthetase with cognate tRNA for genetic code expansionDepositorInsertAckRS and pylTcua
ExpressionBacterialPromoteraraBADAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-NBK-1
Plasmid#207639PurposeA plasmid for the expression of M. mazei pyrrolysine aminoacyl-tRNA synthetase/tRNA pair (PylRS/tRNAPyl) in E. Coli.DepositorInsertPyl-tRNACUA and 2x pyrrolysyl-tRNA synthetase (MmPylRS)
ExpressionBacterialMutationThe evolved synthetase NBK-1 contains mutations Y…PromoteraraBADAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Sm
Plasmid#208001PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Amp
Plasmid#207998PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJBEI-6411
Plasmid#47050PurposeBglBrick plasmid (=pBbB8k-P450) coding for a cytochrome P450 and its associated reductases to oxidize limonene to perillyl alcohol in E. coliDepositorInsertahpG-ahpH-ahpI coding for cytochrome P450 (CYP153A6) and its associated ferredoxin and ferredoxin reductase
UseSynthetic Biology; BglbrickExpressionBacterialPromoterPbadAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.2
Plasmid#88999PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-AcKRS-CloDF
Plasmid#127415PurposeMutant of mmPylRS designed for incorporation of non-canonical amino acids (acyl-lysine derivatives) in to M13 bacteriophageDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialPromoteraraBADAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR-SF61
Plasmid#163916PurposetRNA synthetase/tRNA pair for the in vivo incorporation of para-Pentafluorosulfanyl-Phenylalanine, into proteins in E. coli in response to the amber (TAG) codonDepositorInsertSF5Phe tRNA synthetase
ExpressionBacterialPromoteraraBADAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEDF-PhdRS
Plasmid#127445PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-cannonical amino acids in to M13 bacteriophageDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialMutationN346A-C348A mutations on PylRSPromoteraraBADAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0-i
Plasmid#194639PurposeEmpty pAGE2.0 plasmid with pBAD inducible promoterDepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.1
Plasmid#88994PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.1 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.1 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Sc
Plasmid#109365PurposeHuman rod opsin chimera with intracellular loop 3 from Scallop opsin with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBXNPHM3-Nb_MsbA#1
Plasmid#186428PurposePlasmid for bacterial expression of MsbA binding Nanobody Nb_MsbA#1DepositorInsertNanobody Nb_MsbA#1
UseAffinity Reagent/ AntibodyTags3C cleavage site, His Tag, Maltose Binding Protei…PromoterpBADAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9GG
Plasmid#131009PurposeBackbone plasmid for generating CRISPR arrays for SpCas9 using CRATES. Contains a direct repeat and a RFP-dropout cassette.DepositorInsertsdirect repeat of SpCas9
promoter PJ23119
mRFP expression cassette
UseCRISPRExpressionBacterialPromoterBba_R0040 TetRAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Am
Plasmid#109364PurposeHuman rod opsin chimera with intracellular loop 3 from Amphioxus opsin 1 with 1D4 tagDepositorInsertRod opsin chimera with Amphioxus Opsin1 intracellular Loop 3 (RHO Human, Branchiostoma belcheri)
Tags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only