We narrowed to 5,822 results for: pCas
-
Plasmid#161058PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertFLVCR1 (FLVCR1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCNICK
Plasmid#84653PurposeGenome editing for Lactobacillus casei Lc2WDepositorInsertsCas9 nickase
sgRNA
homology arms of LC2W_2179
UseCRISPRMutationD10AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPRmTmG2
Plasmid#69992PurposeThe CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice.DepositorInsertgRNA that targets near LoxP sites
Available SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p44PPV-eGFP
Plasmid#241907PurposePart 2 of a two-plasmid PCA biosensor composed of the PcaV repressible PPV promoter upstream from a reporter gene (eGFP) on a second plasmidDepositorInsertHis6-eGFP
UseSynthetic BiologyMutationnoneAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHSP02
Plasmid#117259PurposeGenome editing for Lactobacillus plantarum WCSF1DepositorInsertCas9, promotor P11-guide-RNA, homologous arms of Lp_0537
UseOtherAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
p131CB10-tphKAB
Plasmid#241911PurposeTPA catabolic operon under the control of a PCA inducible biosensorDepositorInserttphK, tphA2, tphA3, tphB, tphA1
UseSynthetic BiologyMutationnoneAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pISFba1
Plasmid#226820PurposeExpressing ISEre1 controled by pCas promoter, λ-red recombinase, SacB and ISFba1 guide RNA targeting pMB1 oriDepositorInsertISFba1
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pISEre1
Plasmid#226819PurposeExpressing ISEre1 controled by pCas promoter, λ-red recombinase, SacB and ISEre1 guide RNA targeting pMB1 oriDepositorInsertISEre1
ExpressionBacterialAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC45A3
Plasmid#132167PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC45A3 (SLC45A3 Human)
ExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits