We narrowed to 3,157 results for: bad
-
Plasmid#125177PurposeRetroviral expression of mouse Tbkbp1DepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA
Plasmid#222404Purposearabinose-induced synthesis of a hybrid RNA containing a 5' MS2 hairpin, E. coli chiP 5'UTR insert between XmaI and HindIII sites, surrounded by a 7bp GC clamp, and followed by a 3' trpA terminator.DepositorInsert5’UTR of chiP (-98 to +12, relative to AUG) (chiP E. coli)
Tags1xMS2 hairpin, 7GC clamp, TtrpA terminatorExpressionBacterialPromoterpBADAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Apr
Plasmid#208000PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSG068
Plasmid#214259PurposepJN105 with PaftsH2SD and PaFtsH1 ORF cloned between NheI/XbaIDepositorInsertCore genome PaFtsH1 proteinase from Pseudomonas aeruginosa SG17M
ExpressionBacterialMutation18 nucleotide 5' of the start codon (Shine-D…PromoteraraBAD promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE_RBS3_CB2
Plasmid#201533PurposeExpressing synthetic overlapping gene, ilvA-relE with internal RBS modification. Evolved strain with lower ilvA-relE expression. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE_RBS3_CB2
UseSynthetic BiologyMutationrhaR L128+1bp (frameshift), ilvA G455CPromoterPrhaBAD (rhamnose)Available SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE_RBS3_CB4
Plasmid#201535PurposeExpressing synthetic overlapping gene, ilvA-relE with internal RBS modification. Evolved strain with lower ilvA-relE expression. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE_RBS3_CB4
UseSynthetic BiologyMutationrhaS ΔM1-H5, PrhaSR Δ179bpPromoterPrhaBAD (rhamnose)Available SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+10D+7U
Plasmid#149393PurposeP. aeruginosa PA14 CRISPR2 locus, with 10bp addition downstream,and 7bp addition upstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation7bp inserted upstream, and 10bp inserted downstre…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+10D+10U
Plasmid#149394PurposeP. aeruginosa PA14 CRISPR2 locus, with 10bp addition downstream,and 10bp addition upstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation10bp inserted upstream and downstream of the IHFp…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_IHF_Mut
Plasmid#149396PurposeP. aeruginosa PA14 CRISPR2 locus, with a mutated IHFprox site, that should not be recognized by IHFDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutationIHFprox site is mutated at key positions needed f…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9FnCpf1GG
Plasmid#131013PurposeBackbone plasmid for generating CRISPR arrays for composite array utilized by SpCas9 and FnCas12a using CRATES. Contains a GFP-dropout cassette and two direct repeats.DepositorInsertsdirect repeat of SpCas9
GFP expression cassette
direct repeat of FnCas12a
UseCRISPRExpressionBacterialAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVH003
Plasmid#80397PurposeContains pBAD-CusR (response regulator) and pCusR-antiscaffold-YFP-AAV. This plasmid was used for microscopy tracking experimentsDepositorUseSynthetic BiologyTagsFused by GS linker to LZx domain and Venus has N-…ExpressionBacterialAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
C0080 (araC)_CD
Plasmid#66029PurposeMoClo Basic Part: CDS - Controller protein, araC repressor/activator (activates pBAD, I13453) [C:C0080:D]DepositorInsertTranscription factor
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tau BA 12->7 P301L
Plasmid#203371PurposeFor transfection and in vitro assayDepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas3cRh
Plasmid#133773PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB
Plasmid#162572PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency.DepositorInsertsLambda Red-Beta
E. coli SSB
ExpressionBacterialPromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
tau exon 9–12 splicing minigene
Plasmid#121165PurposeGenerates circular RNAs from a Tau minigeneDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-ABK
Plasmid#126035PurposeEfficient expression of tRNA synthetase/tRNA for the incorporation of a photo-cross-linker, 3’-azibutyl-N-carbamoyl-lysine (AbK) into recombinant protein by amber codon (TAG) suppression in E. coli.DepositorInsertstRNA synthetase 1
tRNA synthetase 2
tRNA for TAG codon
ExpressionBacterialMutationL274M, C313A, Y349FPromoteraraBAD promoter, glnS promoter, and proK promoterAvailable SinceSept. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tau BA 12->10 P301S
Plasmid#203385PurposeFor transfection and in vitro assayDepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only