We narrowed to 7,382 results for: PAC
-
Plasmid#83908Purposestable overexpressionDepositorInsertphosphoserine aminotransferase 1 (PSAT1 Human)
UseTags6x His tagsExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
C-Terminal Split Cas9 with GyrA intein
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianMutationPromoterCBhAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-mSHMT2
Plasmid#83905Purposestable overexpressionDepositorInsertSerine hydroxymethyltransferase 2 (Shmt2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PSPH
Plasmid#83909Purposestable overexpressionDepositorInsertphosphoserine phosphatase (PSPH Human)
UseTags6x His tagsExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSDC803_IKZF1_mutant
Plasmid#224113PurposeInsect cell expression vector for IKZF1 mutant for CRBN cryoEM pre-blottingDepositorInsertIKZF1 (IKZF1 Human)
UseTagsFlag-TEVExpressionInsectMutationResidues 140-196, Q146A and G151NPromoterpolyhedrinAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PHGDH
Plasmid#83907Purposestable overexpressionDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseTags6x His tagsExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgPHGDH-G5
Plasmid#83913Purposestable knockoutDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceOct. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-ICUE
Plasmid#181845PurposeGenetically encoded FRET-based sensor for monitoring cAMP dynamics near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-ICUE (RAPGEF3 Human)
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-WT PHGDH
Plasmid#83901Purposestable overexpressionDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-GPD1
Plasmid#83911Purposestable overexpressionDepositorInsertglycerol-3-phosphate dehydrogenase 1 (GPD1 Human)
UseTags6x His tagsExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgAAVS1
Plasmid#83906Purposestable knockoutDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-PHGDH-C234S
Plasmid#107724PurposeExpression of PHGDH C234S in bacteriaDepositorInsertPHGDH (PHGDH Human)
UseTagsExpressionBacterialMutationC234SPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-C234S PHGDH
Plasmid#83902Purposestable overexpressionDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseLentiviralTagsExpressionMammalianMutationquikchanged cysteine 234 to serinePromoterCMVAvailable sinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable sinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLJM5-mSHMT1
Plasmid#83904Purposestable overexpressionDepositorInsertSerine hydroxymethyltransferase 1 (Shmt1 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-SCYL3
Plasmid#23680DepositorInsertSCYL3 (SCYL3 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only