We narrowed to 81,735 results for: TRI
-
Plasmid#69618PurposeExpress recepter TVA for envA with AAVDepositorInsertAvian sarcoma and leukemia virus receptor 950 (CD320 quail, Synthetic)
UseAAV and Cre/LoxTagsFLAGExpressionMammalianPromoterEF1aAvailable SinceOct. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
K-to-R mutant NPRL2(1-380) in pLJM60
Plasmid#184562PurposeCMV-driven expression of an untagged mutant NPRL2 (core subunit of GATOR1) — native sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.DepositorInsertNPRL2 (NPRL2 Human)
UseLentiviralExpressionMammalianMutationAll lysines were mutated to arginines.PromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCGB3A2_HL-P2A-TagBFP-PGK-NeoR-SCGB3A2_HR
Plasmid#126697Purposedonor vector for targeting a 2A peptide followed by blue fluorescent reporter to the human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertTagBFP
ExpressionMammalianAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
hRAD18 dC2-EGFP
Plasmid#68826PurposeExpresses human RAD18 (deleting Polymerase eta binding domain) tagged with EGFPDepositorInserthuman RAD18 (deleting Polymerase eta binding domain) tagged with EGFP (RAD18 Human)
TagsEGFPExpressionMammalianAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB7 (human) FLAG pSP65
Plasmid#8537DepositorInsertHOXB7 (HOXB7 Human)
UseIn vitro transcription/translationTagsFLAGExpressionBacterialMutationstarts at AA#1 preceeded by FLAG and Ser-Arg-Ile…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
TKTL1
Plasmid#72419PurposeStudy the role of aberrant expression of TKTL1 in HNSCC tumorigenesisDepositorInsertTKTL1 (TKTL1 Human)
ExpressionMammalianMutationmay have one or two synonymous substitutionsPromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-NpHR3.3-EYFP
Plasmid#137151PurposeViral expression of NpHR3.3-EYFPDepositorHas ServiceAAV8InsertNpHR3.3-EYFP
UseAAVMutationW179FPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBabe JunD-HA neo
Plasmid#58486Purposemammalian expression of mouse JunDDepositorAvailable SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook3
Plasmid#198525PurposeExpression of GAL4 DNA-binding domain (BD)-Hook3 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook3 (HOOK3 Human)
TagsGAL4-DNA binding domain (BD) fragmentExpressionYeastPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
H6GB1tevP53(1-303)IntN
Plasmid#200312PurposeBacterial expression of P53 NTAD-DBD for segmental labelingDepositorInsertp53 (TP53 Human)
TagsHis6GB1tev and designed intein NExpressionBacterialMutationM133L, V203A, N239Y, N268DPromoterT7Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pNK3203
Plasmid#219749PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - mcitHispS - tSV40
ExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRF.1 udsVenus (P_JUND)
Plasmid#58692PurposeA rapidly responsive reporter of endogenous JUND promoter activity (Lentiviral expression vector for reporter ultradestabilized Venus)DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SEMPER_ACC-msfBFP[r5M]_ACC-msfGFP[r5M]_ACC-emiRFP670_IRES-mCherry
Plasmid#221081PurposeSEMPER plasmid for expression of msfGFP[r5M] and msfBFO[r5M] and emiRFP670 in ratios dictated by the trinucleotide TIS. Relative ORF expression is characterized in publicationDepositorInsertACC-msfBFP[r5M]_ACC-msfGFP[r5M]_ACC-emiRFP670_IRES-mCherry
ExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #2
Plasmid#83087PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shD
Plasmid#21964DepositorAvailable SinceSept. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CMV-Grid2(I677C)
Plasmid#164782Purposecysteine mutated glutamate delta2 receptor (I677C) for the attachment of a photoswitchable tethered ligandDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-K41M-S285A-T289A-3xFLAG
Plasmid#69842PurposeThis plasmid encodes kinase dead PLK4 isoform 1 carrying K41M and S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
Tags3xFLAG tag and EGFPExpressionMammalianMutationK41M-S285A-T289APromoterCMVAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1_mGFP-FGFR3-K650E
Plasmid#191757PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-K650E mutation (associated with TD2; target mutation: c.1948A>G; silent mutation added on purpose: c.1938C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1948A>G (p.K650E) + silent mutation c.1938C&…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-NLS-BirA-2A-mCherry_Ras
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Dakap-Venus-cpVenus-FLARE-AKAR
Plasmid#123338PurposeMitochondria-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertDAKAP-Venus-cpVenus-FLARE-AKAR
TagsN-terminal 30 amino acids from DAKAP1, Venus, and…ExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP WT
Plasmid#197567PurposeExpression of sfGFP WT with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6) (4x copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge (pos. CTRL)
Plasmid#117327PurposeDual luciferase assay positive control for miR-124 bindingDepositorInsertmiR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His K206E/K534A hTFNG
Plasmid#70133PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to release iron from the N-lobe or the C-lobeDepositorInsertN6His K206e/K534A hTFNG (TF Human)
TagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationchanged Lys206 to a glutamic acid and Lys534 to a…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge_rev(neg. CTRL)
Plasmid#117326PurposeDual luciferase assay negative control for miR-124 bindingDepositorInsertreverse miR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CreLite
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-G380R
Plasmid#191755PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-G380R mutation (associated with ACH; target mutation: c.1138G>A; silent mutation added on purpose: c.1131C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1138G>A (G380R) + c.1131C>T (silent mutat…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 Flag GFP 4E-BP1 Rheb15
Plasmid#112761Purposeexpress GFP-4EBP1-Rheb15DepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-cpVenus-FLARE-EKAR-EV
Plasmid#123339PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-EKAR-EV
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX 4t1 RARalpha (1-187)
Plasmid#35558DepositorAvailable SinceApril 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPKm-230
Plasmid#90499PurposepSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.DepositorInsertmito-tFD and mito-tFNR
UseLentiviralAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-MPG(N169D)
Plasmid#23259DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only