We narrowed to 3,157 results for: bad
-
Plasmid#203383PurposeFor transfection and in vitro assayDepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1 NKX6-2-Venus R200W
Plasmid#209179PurposeMammalian expression of SPAX8-related missense mutation (R200W) in human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (R200W) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationNKX6-2 (R200W)PromoterCMVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-196)-Venus
Plasmid#209182PurposeMammalian expression of human NKX6-2 cDNA SPAX8-related truncated mutation containing the amino acids 1 to 196; fused with the green fluorescent protein Venus allowing the use of fluorescent based protocols.DepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2-Venus L163V
Plasmid#209178PurposeMammalian expression of SPAX8-related missense mutation (L163V) in human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (L163V) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationNKX6-2 (L163V)PromoterCMVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-188)-Venus
Plasmid#203714PurposeSPAX8-related truncated mutation (E189*) containing the amino acids 1 to 188 of human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (1-188) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 189-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-40)-Venus
Plasmid#203713PurposeSPAX8-related truncated mutation (K41*) containing the amino acids 1 to 40 of human NKX6-2, fused with the Venus fluorescent protein.DepositorInsertNKX6-2 (1-40) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 41-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-Cas12m-ΔZF
Plasmid#192276PurposeEncodes MmCas12m ΔZF (H549A, C552A) under a constitutive promoterDepositorInsertCas12m ΔZF
UseCRISPRExpressionBacterialMutationH459A, C552APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m-ΔZF
Plasmid#192277PurposepCas-dCas12m-ΔZF (D485A, H549A, C552A) under a constitutive promoterDepositorInsertMmdCas12m ΔZF
UseCRISPRExpressionBacterialMutationD485A, H549A, C552APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRha-ABE8e-SpCas9-NG
Plasmid#201190PurposeExpresses the base editor ABE8e-SpCas9-NG in bacterial cellsDepositorInsertABE8e-SpCas9-NG
Tags8xHIS and BP-NLSExpressionBacterialPromoterpRhaBADAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-RFP entry
Plasmid#192278PurposeEntry vector for cloning MmCas12m spacers. RFP flanked by MmCas12m CRISPR repeats can be digested out with BbsI.DepositorInsertRFP flanked by type V-M CRISPR repeat sequences
UseCRISPRExpressionBacterialPromoterPJ23119Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB-EcMutLE32K
Plasmid#162576PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency. Contains a dominant negative mismatch repair protein.DepositorInsertsLambda Red-Beta
E. coli SSB
EcMutLE32K
ExpressionBacterialMutationE32K mutated to give dominant negative phenotypePromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas-MmdCas12m-CBE1
Plasmid#192284PurposeMmdCas12m-CBE1 expressed under a constitutive promoterDepositorInsertMmdCas12m-CDA-UGI
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
MBP-rPKM2 WT
Plasmid#107158PurposeMBP-rPKM2 WT for production and purification of rat PKM2 WTDepositorInsertMBP-tagged rat pyruvate kinase M2 isoform (Pkm Rat)
TagsC-term 6-his and N-term MBPExpressionBacterialPromoterPBADAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW57.kc1-HSD17B10
Plasmid#164076PurposeHuman codon optimized HSD17B10. Expression is controlled by doxycycline.DepositorInsertHSD17B10 (HSD17B10 Human)
ExpressionMammalianAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
MBP-rPKL WT
Plasmid#107156PurposeMBP-rPKL WT for production and purification of rat PKL WTDepositorInsertMBP-tagged rat pyruvate kinase liver isoform (Pklr Rat)
TagsC-term 6-his and N-term MBPExpressionBacterialPromoterPBADAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-PDE6B-146
Plasmid#239098PurposepGL3 luciferase vector with 146bp PDE6B promoter (containing NRL response element).DepositorArticleInsertPDE6B promoter (PDE6B Human)
UseLuciferaseAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
t1-435
Plasmid#166578PurposeFor expression of human talin head (residues 1-435) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-435) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-435 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only