We narrowed to 1,681 results for: sfGFP
-
Plasmid#163739PurposeConstitutive expression of green fluorescent protein encoding ten stop codonsDepositorInsertlldr gfp.10TAG
ExpressionBacterialMutationgfp with first 10 leucine codons mutated to amberAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG74-β2AR-sfGFP
Plasmid#102460PurposeExpresses a fusion protein of wild type β2 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
1xNLS-pMJ915v2-sfGFP
Plasmid#88919PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNP1 AND gate sfGFP
Plasmid#107361PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 AND input A and pNP1 AND input B are co-expressedDepositorInsertAND gate + sfGFP
ExpressionBacterialPromoterT7Available SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-pMJ915v2-sfGFP
Plasmid#88920PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1-2A-sfGFP
Plasmid#240098Purposehuman PAX3::FOXO1 in -2A-sfGFP backbone (Plasmid# 74668)DepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1ΔHD-2A-sfGFP
Plasmid#240099Purposehuman PAX3::FOXO1 with homeobox domain deletion in -2A-sfGFP backbone (Plasmid# 240099)DepositorExpressionMammalianMutationremoved amino acids 218-278 for the homeobox DNA …Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.SynFLEX.(cyto).cpSFGFP.mRuby3
Plasmid#244914PurposecpSFGFP control with non-responsive mRuby3DepositorInsertcpSFGFP.mRuby3
UseAAVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.SynFLEX.(cyto).cpSFGFP.mIRFP670nano3
Plasmid#244918PurposecpSFGFP control with non-responsive mIRFP670nano3DepositorInsertcpSFGFP.mIRFP670nano3
UseAAVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_7-8_006_Kan/ColEI_sfGFP
Plasmid#235972PurposeKanamycin/ColEI backbone with sfGFP placeholder for lvl2 assemblyDepositorInsertKan/ColEI
UseSynthetic BiologyAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-3x-55-96
Plasmid#232015PurposeExpression of 3 tandem copies of CHMP2B helix 2, connected with gly-ser linkers, attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-55-96
Plasmid#232014PurposeExpression of CHMP2B helix 2 attached to sfGFP.DepositorInsertCHMP2B (CHMP2B Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
phSyn2 sfGFP-RNF152
Plasmid#215374PurposeLentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter.DepositorInsertRNF152 (RNF152 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1-Pls2-sfGFP
Plasmid#205749PurposeExpresses sfGFP under IPTG inducible promoter Pls2 in high copy pTRKH2 gram-positive shuttle vector. Used in Lactobacillus gasseri. Medium/low strength.DepositorTypeEmpty backboneUseShuttle vector gram+ gram-ExpressionBacterialPromoterPls2 (Phyperspank mutant, IPTG inducible)Available SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFPcp-natMX6
Plasmid#240557PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with circularly permuted superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFPcp
ExpressionYeastAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFP-kanMX6
Plasmid#240551PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFP
ExpressionYeastAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFPcp-hphNT1
Plasmid#240558PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with circularly permuted superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFPcp
ExpressionYeastAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFP-hphNT1
Plasmid#240552PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFP
ExpressionYeastAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only