We narrowed to 44,705 results for: cha;
-
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferasePromoteralpha ENACAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC-SUR-YR
Plasmid#61768PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing sulfonylurea resistance gene (ILV alelle from Magnaporthe oyrzae) on transfer DNA (TDNA).DepositorInsertsSur gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromoterMagnaporthe oryzae ILV promoterAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-RRBP1-WPRE-UbC-Emerald
Plasmid#225942PurposeLentiviral vector plasmid expressing human ribosome binding protein 1 (RRBP1) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (Wuhan variant)
Plasmid#169846PurposeMammalian expression plasmid for S of SARS-CoV-2 (Wuhan variant) with N-terminal c-myc tagDepositorInsertProtein S
TagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
ReactionC_pBIG1a_ATG7_ATG10
Plasmid#190860PurposePlasmid for the expression and purification of ATG7 and ATG10 protein subunit complexes. Internal reference: SMC1179DepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-HA-Slc1a5 (mouse)
Plasmid#71458Purposeinducible expression fo Slc1a5 in mammalian cellsDepositorInsertSlc1a5 (Slc1a5 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationA85P, L125F and V384A mutations compared to GenBa…PromoterCMVAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-HRV3C
Plasmid#164567PurposeSARS-CoV-2 Spike protein with furin site mutated to HRV3C site (S-HRV3C variant)DepositorInsertSpike - Furin site changed for HRV3C site
Tags2X Strep-Tag II and 8X His tagExpressionMammalianMutation682-685 (furin site) replaced with HRV3C site (LE…Available SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-hsChRmine-oScarlet-WPRE
Plasmid#183526PurposeOptogeneticsDepositorInserthsChRmine-oScarlet
UseAAVMutationH33RPromoterEf1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRP1MX6-ins4
Plasmid#195041PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertTRP1
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-xBE3-P2A-Puro
Plasmid#110870PurposeLentiviral vector for constitutive expression of xCas9(3.7)-BE3 in mammalian cellsDepositorInsertxCas9(3.7)-BE3
UseLentiviralMutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro CCND2-T2A-luciferase-P2A-eGFP
Plasmid#179843PurposeTunable and temporal expression control of CCND2, luciferase and nuclear eGFPDepositorInsertCCND2 (CCND2 Human)
UseLuciferase and Synthetic BiologyTagseGFP and luciferaseExpressionMammalianPromoterTRE3GAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-rsChRmine-eYFP-WPRE
Plasmid#183531PurposeOptogeneticsDepositorInsertrsChRmine-eYFP
UseAAVMutationI146M/G174SPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Triple ORF LoxP ifgMosaic Donor (LH208)
Plasmid#99625PurposeTo clone the 3 ORFs for Cre dependent generation of ifgMosaicsDepositorInsertN-PhiM
UseCre/Lox, Mouse Targeting, and Synthetic BiologyAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CBA-hGBA1-cm-hGBA1-hGHpA
Plasmid#218795PurposeAAV reporter genome plasmidDepositorInsertCMV-CBA-hGBA1-cm-hGBA1-hGHpA
UseAAVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LoxP1-His-H2B-Cherry-2A (SO290)
Plasmid#99616PurposeTo clone gene of interest downstream of LoxP1-His-H2B-Cherry-2A cassetteDepositorInsert6xHis-H2B-Cherry
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28-Kss1
Plasmid#52682PurposeExpression of Kss1 in bacteriaDepositorAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
USPL1cat-C236S-pEYFP_C1
Plasmid#85767Purposemammalian expression of USPL1 catalytic domain (aa 212-514) as YFP fusion, catalytic inactive variant C236SDepositorInsertUSPL1, catalytic domain (aa 212-514), catalytic inactive variant C236S (USPL1 Human)
TagsEYFPExpressionMammalianMutationcatalytic domain (aa 212-514), catalytic inactiv…PromoterCMVAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28(+)-NudC
Plasmid#175022PurposePurification of NudC enzymeDepositorInsertnudC
Tags6xHisExpressionBacterialPromoterT7Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAVA-LGF2(fs)-Gal11p(fs)
Plasmid#127483PurposeNegative control for the AVA-seq system. LGF2 (with one nucleotide insertion) (lambda CI associated) and Gal11p (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertLGF2 (frame shift)-Gal11p (frame shift) (GAL11 Budding Yeast)
ExpressionBacterialMutationOne nucleotide inserted between lambda CI and LGF…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_deltaLC
Plasmid#98664PurposeExpresses MBP-tagged hnRNPA2 without the LC domainDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS15
Plasmid#107929Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS14
Plasmid#107928PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hsChRmine-eYFP-WPRE
Plasmid#183530PurposeOptogeneticsDepositorInserthsChRmine-eYFP
UseAAVMutationH33RPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-miRFP670-Cry2WT
Plasmid#122441PurposeExpresses disordered protein FUS(1-214) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertFUS (FUS Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationContains only amino acids 1-214PromoterSFFVAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_D290V
Plasmid#98663PurposeExpresses MBP-tagged full length hnRNPA2 with D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_P298L
Plasmid#104468Purposeexpress MBP-tagged full length hnRNPA2 P298LDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB(C460S)
Plasmid#183677PurposeRecombinant Salmonella Typhimurium SopB (catalytically inactive)DepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium, Budding Yeast)
TagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialMutationC460SPromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/myc-His-A-YAP2-1st&2nd WW mut
Plasmid#19061DepositorInsertYes-kinase associated protein (YAP1 Human)
ExpressionMammalianMutationTryptophan 199 changed to Alanine,and Proline 202…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st&2nd WW mutant
Plasmid#19000DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
ExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xnr UAS ifgMosaic Donor vector (IG230)
Plasmid#99631PurposeTo clone the 3 ORFs for Gal4 dependent generation of ifgMosaicsDepositorInsertN-PhiM
UseCre/LoxAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only