We narrowed to 11,447 results for: nar;
-
Plasmid#187222PurposeExpresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertNuclear Factor I B (NFIB Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-tagBFP-HDR
Plasmid#163751PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertSOX2 (SOX2 Human)
UseCRISPR and Synthetic BiologyTagsP2A-tagBFPMutationDoes not contain start codon to avoid random inte…Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
FnoCas12a-2C-NLS in pCSDest
Plasmid#126639PurposeExpresses FnoCas12a-2C-NLS in mammalian cellsDepositorInsertFnoCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianPromoterCMV IE94 promoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMMDS DEST
Plasmid#206264PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. After LR propagate in Pir+. Works as a CRE-donor in the MultiBac system.DepositorTypeEmpty backboneUseCre-donor, multimate/gateway dest vector (multiba…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KQ403: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-LSD1
Plasmid#121831PurposepMAGIC R4-R3 entry plasmid, contains 2x NLSx-dCas9(3.7) fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-luciferase
Plasmid#113353Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseLuciferaseAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4495
Plasmid#80338Purposemammalian expression MbCpf1 nuclease and Mb crRNADepositorInsertsMb crRNA
MbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6MBW6
Plasmid#103102PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6MBW6(Cas9 coding gene from Staphylococcus lugdunensis M23590)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
shFGF2#2
Plasmid#157668PurposeTet inducible knockdown of FGF2DepositorAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRD421
Plasmid#163112PurposeProduction of His6_TEV-cleavable-linker_mEos3.2_H-NSdbd in BL21 (DE3) pLysSDepositorInsertHis-tag_TEV-cleavable-linker_mEos3.2_H-NSdbd
TagsHis-tag with TEV-cleavable linkerExpressionBacterialPromoterT7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E3CY56
Plasmid#103075PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE3CY56(Cas9 coding gene from Aminomonas paucivorans DSM 12260)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE4938
Plasmid#107527PurposeExpresses Fn crRNA and mCherry in mammalian cells.DepositorInsertsFn crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only