We narrowed to 7,279 results for: gnal
-
Plasmid#47799PurposeExpresses enzymatically monobiotinylated full-length RON3 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RON3
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP4-bio
Plasmid#47717PurposeExpresses enzymatically monobiotinylated full-length MSP4 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP4
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RASEFIR-HA
Plasmid#46863Purposeexpresses mouse IL-17RA with SEFIR deletionDepositorInsertIL-17RA-delta-SEFIR (Il17ra Mouse)
Tags3x HAExpressionMammalianMutationDeletion of SEFIR domain (AA 394-485)PromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-PRKAA2ΔC
Plasmid#30307DepositorInsertAMP-activated Protein Kinase α2 ΔC (Prkaa1 Rat)
TagsGFPExpressionMammalianMutationdeleted amino acids Ser 527 to Arg 552Available SinceAug. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-DipA-ss
Plasmid#137068PurposeE. coli expression clone (T7lac promoter) for mature DipA (aa 21-342) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature DipA: lacks the DipA signal peptidePromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-BB0323-ss
Plasmid#137067PurposeE. coli expression clone (T7lac promoter) for mature BB0323 (aa 20-377) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAC66700.1
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationmature BB0323: lacks the BB0323 signal peptidePromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-2XPRE-GFP
Plasmid#206169PurposepMVP Gateway destination vector (3rd generation lentiviral vector) containing 2 consensus PGR binding sites upstream of a minimal 2YBTATA promoterDepositorInsert2X PRE-eGFP
UseLentiviralPromoter2YBTATAAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-4XPRE-GFP
Plasmid#206170PurposepMVP Gateway destination vector (3rd generation lentiviral vector) containing 4 consensus PGR binding sites upstream of a minimal 2YBTATA promoterDepositorInsert4X PRE-eGFP
UseLentiviralPromoter2YBTATAAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
BcLOV4 fusion tools screening plasmid #2
Plasmid#174512PurposeCloning plasmid for creating BcLOV4 optogenetic tool fusions. Expresses [BamHI]-mCherry-[XhoI]-GGGSx2-BcLOV4-[EcoRI]-GGGS-3xFLAG-STOP in a pcDNA3.1 backbone.DepositorInsertplasmid B [BamHI]-mCherry-[XhoI]-GGGSx2-BcLOV4-[EcoRI]-GGGS-3xFLAG-STOP
Tags3xFLAG and mCherryExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
canxTM-mEmerald (cytosolic)
Plasmid#186962PurposeExpresses mEmerald connected with the C-terminus of Calnexin transmembrane domain.DepositorInsertCANX (CANX Human)
TagsmEmeraldExpressionMammalianMutationOnly express calnexin (482-end) and add ER signal…PromoterCMV PromoterAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pLENTI-CAG-IRES-GFP
Plasmid#176992PurposeMammalian lentiviral expression vector encoding GLI1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDNA3-Cerulean-FHA1-NES
Plasmid#138202PurposeEncodes N-terminal (PAABD) fragment of FRET-based bimolecular kinase activity reporters (BimKARs); cytosol targeted.DepositorInsertCerulean-FHA1-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-SVIP-Strep-HA
Plasmid#113491PurposeExpression of human SVIP with C-terminal strep-HA tagDepositorInsertSVIP (SVIP Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Grb10-WT
Plasmid#74501PurposeOverexpression of Grb10 in mammalian cellsDepositorInsertGrb10 (GRB10 Human)
TagsFLAGExpressionMammalianMutationL358S, V522A, and V524LPromoterCMVAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rgl2-CAAX-pcw107-V5
Plasmid#64641Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertRgl2 plus C-term KRAS (Kras Mouse)
UseLentiviralTagsV5MutationC-term of KrasPromoterPGKAvailable SinceDec. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
JNK2 WT O/E (MAPK9)-pcw107-V5
Plasmid#64617Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertMAPK9 (transcript variant JNK2-a2) (MAPK9 Human)
UseLentiviralTagsV5MutationnonePromoterPGKAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
3xFN-Tel-TAL/pCMV-7.1
Plasmid#63589PurposeExpresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat.DepositorInsert3xFVN-Tel-TAL
UseTALENTags3xFLAG-tag, V5-tag, and nuclear localization sign…ExpressionMammalianPromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only