We narrowed to 30,664 results for: PLE
-
Plasmid#210344PurposeExpresses SARS-CoV-2 NSP2 in mammalian cellsDepositorInsertSARS-CoV-2 NSP2 (ORF1ab Human, SARS-CoV-2 isolate Wuhan-Hu-1)
TagsFlagExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP3C-mCherry
Plasmid#210377PurposeExpresses the C terminal of SARS-CoV-2 NSP3 fused with mCherry tag in mammalian cellsDepositorInsertNSP3C (ORF1ab SARS-CoV-2)
TagsmCherryExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
SEC61B-2Strep
Plasmid#210375PurposeExpresses SEC61B fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
TMEM106B-2Strep
Plasmid#210360PurposeExpresses TMEM106B fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, pai…Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_19kDa_EE
Plasmid#74951PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 19kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsGlu-Glu tag (EYMPME)ExpressionMammalianMutationdelta 1-127PromoterCMV, lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_23kDa_Myc
Plasmid#74949PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 23kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsHA Tag (YPYDVPDYA)ExpressionMammalianMutationdelta 1-99 M128APromoterCMV, Lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(WT)
Plasmid#112720PurposeWild-type TBP6.7 was one of the first evolved TAR-binding proteins to bind with exceptional affinity. It was this protein that was used to obtain co-crystals with WT TAR RNA.DepositorInsert6His-TEV-TBP6.7(WT)
Tags6His-TEVExpressionBacterialPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P46A)
Plasmid#112721PurposeThis mutation (P46A) marks the first residue within the evolved region of U1A.DepositorInsert6His-TEV-TBP6.7(P46A)
Tags6His-TEVExpressionBacterialMutationP46APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q48T)
Plasmid#112725PurposeThis mutant of TBP6.7 binds to TAR very similarly to TBP6.7(WT), with only 1.4-fold reduced Kd.DepositorInsert6His-TEV-TBP6.7(Q48T)
Tags6His-TEVExpressionBacterialMutationQ48TPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P51A)
Plasmid#112728PurposeSimilar to P46, P51 was selected and is present in all evolved TBPs. Mutating this position into Ala has a modest effect on binding.DepositorInsert6His-TEV-TBP6.7(P51A)
Tags6His-TEVExpressionBacterialMutationP51APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q54A)
Plasmid#112730PurposeAlthough not evolved, this residue within TBPs participates in stabilizing the polypeptide loop responsible for RNA recognition.DepositorInsert6His-TEV-TBP6.7(Q54A)
Tags6His-TEVExpressionBacterialMutationQ54APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1957
Plasmid#82568PurposeHigh copy number plasmid containing hs1218 MiniPromoter insert.DepositorInserthshs1218
UsePleiades promoter project [sic, pleaides plieades]Available SinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1953
Plasmid#82567PurposeHigh copy number plasmid containing hs671 MiniPromoter insert.DepositorInserths671
UsePleiades promoter project [sic, pleaides plieades]Available SinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCIG1_UL136_25kDa_Myc
Plasmid#74954PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 25kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTags3xFLAG (GGGGDYKDDDDKGADYKDDDDKEFDYKDDDDK)ExpressionMammalianMutationdelta 1-77, M100A M128APromoterCMV, Lentiviral LTRAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Ywhab-3'UTR-MRE-1 MUT
Plasmid#61796PurposeLuciferase reporter containing the 3'UTR of mouse Ywhab with MRE-1 mutatedDepositorInsertmouse Ywhab 3'UTR with miR-200c MRE-1 mutated
UseLuciferaseMutationmiR-200c MRE-1 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Xbp1-3'UTR-MRE-3 MUT
Plasmid#61793PurposeLuciferase reporter containing the 3'UTR of mouse Xbp1 with MRE-1 mutatedDepositorInsertmouse Xbp1 3'UTR with miR-200c MRE-3 mutated
UseLuciferaseMutationmiR-200c MRE-3 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Smad5-3'UTR-MRE-1 MUT
Plasmid#61791PurposeLuciferase reporter containing the 3'UTR of mouse Smad5 with MRE-1 mutatedDepositorInsertmouse Smad5 3'UTR with miR-200c MRE-1 mutated
UseLuciferaseMutationmiR-200c MRE-1 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only