We narrowed to 4,447 results for: gca
-
Plasmid#69238PurposeU6 driven SpCas9 sgRNA expression for KANK3 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-puro-cfSec15A_5
Plasmid#26716DepositorInsertDog Sec15A RNAi (EXOC6 C. familiaris (dog RNAi))
UseLentiviral and RNAiExpressionMammalianMutationDog Sec15A-specific RNAi.Available SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-2
Plasmid#210130Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-R-GECO1
Plasmid#46021PurposeRed intensiometric genetically encoded Ca2+-indicators for optical imagingDepositorInsertR-GECO1
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-GEM-GECO1
Plasmid#32461PurposeMammalian expression of mitochondria-targeting blue-green emission ratiometric genetically encoded Ca2+ indicator for optical imagingDepositorInsertGEM-GECO
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationGCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S…PromoterCMVAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLkb1/Cre
Plasmid#66894PurposeExpresses an Lkb1-targeting gRNA and Cre-recombinaseDepositorInsertsgLkb1
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #2
Plasmid#136585PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shPOLE1_1
Plasmid#160810PurposeExpress Dox repressible shPOLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001146329)
Plasmid#77720Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001144984)
Plasmid#77721Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTK2 gRNA (BRDN0001146703)
Plasmid#75544Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
Plasmid#190112PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFPDepositorInsertsMMLV-RT(dRH)
U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
UseAAVTagsbpNLS and bpNLS-P2A-eGFPMutationmutations from RT in PE2 and truncation of RNAse …PromoterEFS and U6, H1Available SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorInsertgRNA target sequence for luciferase control
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only