We narrowed to 12,964 results for: BASE
-
Plasmid#199264PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one miniU6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine
Plasmid#178825PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6b_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-POLB-KO-g1
Plasmid#176090PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassetteDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD443
Plasmid#168469PurposeFor the insertion pf NLS-mScarlet-I-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mScarlet-I-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H171
Plasmid#170353PurposemTurq2Del_EPACdDEPCD_Q270E_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_Q270E_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M3_3-pTRNA-scf 2.1 (GB2075)
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (-cyt)
Plasmid#137825Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic region - N213S on the CD44 re…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-C
Plasmid#156471PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-C protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-C (ORF1ab Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3e_NAB
Plasmid#156473PurposeBacterial expression of Sars-CoV2 Nsp3e_NAB protein with His-tag and GST-tagDepositorInsertNsp3e_NAB (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA901: pMVP (L3-L2) HA tag + pA; EF1a::eGFP-P2A-TETa-pA
Plasmid#121804PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + EF1a-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream EF1a-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + EF1a::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA701: pMVP (L3-L2) HA tag + pA; RIP::eGFP-P2A-TETa-pA
Plasmid#121808PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + RIP::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HS1BP3-PX (17-139)
Plasmid#119125PurposeBacterial expression of human phox homology (PX) domain, HS1BP3-PX (17-139)DepositorAvailabilityAcademic Institutions and Nonprofits only -
N-term AAV-ABE8e-SpCas9(S55R) (CA21)
Plasmid#242659PurposeCBh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-SpCas9(S55R) - to be used with eVRQR constructsDepositorInsertpAAV-pCBh-BPNLS(SV40)-TadA8e-gs-SpCas9(D10A;S55R)-[N-term]-NpuN-BPNLS(SV40)-WPRE-bGH_PA
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationSpCas9(S55R)PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pChillyBoys_gen1
Plasmid#228495PurposepACYCDuet-1 encoding Oleispira antarctica GroEL and GorES low temp chaperonins for enhanced low-temperature induction (E. coli based protein expression)DepositorInsertsgroEL
groES
ExpressionBacterialPromoterT7 PromoterAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCWU50
Plasmid#232318PurposeA conditional plasmid system where RepA, required for pCWU6-based plasmid replication, is regulated by an inducible fdx promoter and theophylline-responsive riboswitchDepositorInsertPfdx-E
ExpressionBacterialPromoterfdxAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
SUMO-PNGaseF
Plasmid#228498Purpose10xHis-SUMO (Smt3) tagged PNGaseF (E. coli based protein expression)DepositorInsertngl
Tags10xHis-SUMO(Smt3)ExpressionBacterialPromoterT7 PromoterAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Clover2-N1
Plasmid#54537PurposeLocalization: N1 Cloning Vector, Excitation: 505, Emission: 515. This plasmid encodes dClover2 H231L based on Bajar et. al. Sci Rep. 2016.DepositorTypeEmpty backboneTagsClover2ExpressionMammalianAvailable SinceJune 12, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET15-MHL
Plasmid#26092PurposeSGC Empty backbone for bacterial expression under T7 promoter. Uses infusion based cloning method.DepositorTypeEmpty backboneTags6xHis and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceSept. 6, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAS_4xMmaPylT_EF1_mCherry_TAG_EGFP
Plasmid#174893Purposeamber suppression reporter mCherry-TAG-EGFP expression, with MmaPylT amber suppressor tRNA cassetteDepositorInsertmCherry and EGFP
ExpressionMammalianPromoterEF1Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clover2-C1
Plasmid#54711PurposeLocalization: C1 Cloning Vector, Excitation: 505, Emission: 515. This plasmid encodes dClover2 H231L based on Bajar et. al. Sci Rep. 2016.DepositorTypeEmpty backboneTagsClover2ExpressionMammalianAvailable SinceJune 12, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
BII-gR-PnTW
Plasmid#133356PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications) coexpressed with tdTomato-NLSDepositorInserttdTomato-NLS
TagsHA-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-AktAR2
Plasmid#125195PurposeSB-transposon plasmid for stable expression of AktAR2 variant of FRET-based AKT activity reporterDepositorInsertAktAR2
UseTransposonTags6xHis, T7, and Xpress, mCerulean3 and cpVenus[E17…ExpressionMammalianPromoterEF1a/RPBSAAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
dClover2-Cx43-7
Plasmid#56532PurposeLocalization: Gap Junctions, Excitation: 505, Emission: 515. This plasmid encodes dClover2 A206K, H231L based on publication.DepositorInsertCx43
TagsdClover2ExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMH_AtCK2beta1_95-287_NoTag
Plasmid#238520PurposeBacterial expression of A. thaliana CK2beta1 95-287_NoTagDepositorInsertAtCK2beta1 (CKB1 Mustard Weed)
ExpressionBacterialAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMH_AtCK2alpha1_76-409_K318A_H347A_K350A_K148/149A_K146A_HC
Plasmid#238515PurposeBacterial expression of A. thaliana CK2alpha1 76-409_K318A_H347A_K350A_K148/149A_K146A_HCDepositorInsertAtCK2alpha1 (CKA1 Mustard Weed)
Tags6xHisExpressionBacterialMutationK318A_H347A_K350A_K148/149A_K146AAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMH_AtCK2alpha1_76-409_K146A_K148/149A_HC
Plasmid#238516PurposeBacterial expression of A. thaliana CK2alpha1 76-409_K146A_K148/149A_HCDepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNYCOMPS-C-Lic-His-FLAG
Plasmid#182505PurposepET based vector for protein expression in E.coli for targets fused with C-terminal Flag and HisDepositorTypeEmpty backboneTagsTEV-FLAG-10x HisExpressionBacterialPromoterT7Available SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNYCOMPS-N-Lic-His-FLAG
Plasmid#182506PurposepET based vector for protein expression in E.coli for targets fused with N-terminal Flag and HisDepositorTypeEmpty backboneTags10xHis-FLAG-TEVExpressionBacterialPromoterT7Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
thoc5.018.389
Plasmid#137266PurposeExpresses N-terminal (His)6-TEV cleavage site fusion of human gene or portion of gene in bacterial strains. pET based vector.DepositorAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
NKAP.001.140
Plasmid#137206PurposeExpresses N-terminal (His)6-TEV cleavage site fusion of human gene or portion of gene in bacterial strains. pET based vector.DepositorAvailable SinceJan. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
L4440
Plasmid#1654DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAiTagsT7p, T7p, lacZN, OriF1>>, OriF1<<ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pT7TS-rich
Plasmid#99050PurposeThis plasmid is useful for in vitro transcription of genes using T7 promoter. Can be used for Xenopus oocyte assay. It is derived from pT7TS. More sites for cloning are incorporated.DepositorTypeEmpty backboneUseUnspecified; Xenopus oocyte systemPromoterpT7Available SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8eWQ
Plasmid#161815PurposeExpresses ABE8eWQ in mammalian cellsDepositorInsertbpNLS-TadA8e(V106W/D108Q)-32AA linker-hSpCas9(D10A)-bpNLS-P2A-EGFP-NLS
UseCRISPRExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…Available SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Puro_LPAR_AKAR-WT
Plasmid#125206PurposeSB-transposon plasmid for stable expression of lipid raft-targeted FRET-based PKA activity reporterDepositorInsertLPAR_AKAR-WT
UseTransposonTagsEV linker, cpVenus[E172] and Lyn tag (GCIKSKRKD),…ExpressionMammalianPromoterEF1a/RPBSAAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCODE-3
Plasmid#247475PurposePlasmid for inducible expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operon, tRNA flanking regio…PromoterpTetAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMH_MBP_AtCCA1_88-198
Plasmid#238517PurposeBacterial expression of A. thaliana CCA1 88-198DepositorInsertAtCCA1 (CCA1 Mustard Weed)
Tags2x Strep, 6x His, MBP, N-term, TEV cleavableExpressionBacterialAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG7084 pG46-46
Plasmid#232621PurposepG46 derivative containing two replacement cassette sites (siteA and siteB) for gap-replacement-based chemical modification(s).DepositorTypeEmpty backboneUsePrecursor plasmid to generate modified dna circlesAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only