We narrowed to 35,133 results for: LAT
-
Plasmid#112284PurposeFluorescently labels WT human YAP1-2gamma isoform (504 aa)DepositorAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pRL-TK let7 B
Plasmid#11325DepositorInsert2 binding sites for let-7a miRNA
UseLuciferaseTagsRr-lucMutationMutation B from figure 4A of paper.Available SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSIN4-EF1a-LMO2-IRES-Puro
Plasmid#61064Purposelentiviral vector for LMO2DepositorAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH2B-LSSmOrange
Plasmid#37133DepositorInsertLSSmOrange
Tagshistone 2BExpressionMammalianMutationA44V/F84L/W145M/I165D/M167L/G202D compared to mOr…PromoterCMVAvailable SinceJune 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRK5 FLAG wildtype, catalytic dead lipin 1
Plasmid#32006DepositorInsertLipin1 (Lpin1 Mouse)
TagsFLAGExpressionMammalianMutationD712E and D714EPromoterCMV, SP6Available SinceOct. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
2XMyc-LRRK2-D1994A
Plasmid#25368DepositorInsertLRRK2 (LRRK2 Human)
Tags2XMycExpressionMammalianMutationAspartate 1994 mutated to AlanineAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
LB335 (Bcl-2 from ATG to -1281)
Plasmid#15382DepositorInsertB-cell lymphoma/leukemia-2 (BCL2 Human)
UseLuciferaseTagsLuciferaseExpressionBacterialMutationBcl-2 fragment from ATG to -1281 with P2Available SinceAug. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai1
Plasmid#196048PurposeEncodes a G alpha subunit (GNAl1) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P28
Plasmid#120039PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with 3xHADepositorInsert3xHA
UsePcr templateTags3xHAPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT3T4
Plasmid#50595PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-26t plus, OsU3p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAmCyan1-C1-ADCY6
Plasmid#113905PurposeN-terminal Cyan Fluorescent tag in Adenylate Cyclase 6DepositorAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCB-hDot1Lmut
Plasmid#74174PurposeFor packaging hDot1Lmut (catalytic activity dead) to retrovirus.DepositorAvailable SinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFF745
Plasmid#61450PurposeIPTG-inducible SCRIBE_kanR(ON)DepositorInsertSCRIBE_kanR(ON)
UseSynthetic BiologyPromoterpLacOAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-StrepHA-SUMO2
Plasmid#66867PurposeMammalian expression of SUMO2 with a strep and an HA tagDepositorAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSyn-PROGERIN
Plasmid#140189PurposeOverexpression of Progerin with a GFP fusion protein, under human synapsin promotorDepositorAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMito-PAGFP-FRB.
Plasmid#60005PurposeExpresses MitoTrap tagged with photo-activatable GFP in mammalian cells.DepositorTypeEmpty backboneUseKnocksidewaysTagsFRB and PAGFPExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Hinge Notch SNIPR (Notch2 JMD)
Plasmid#188375PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only