We narrowed to 8,888 results for: tre promoter
-
Plasmid#133821PurposeEncodes the C2B domain of synaptotagmin 1 with membrane-penetrating residue mutations V304A,I367A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPExpressionMutationV304A, I367APromoterhSyn (human synapsin I promoter)Available sinceAvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A K189-192A IRES GFP
Plasmid#133823PurposeEncodes the C2A domain of synaptotagmin 1 with poly-lysine patch mutations K189-192A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPExpressionMutationK189-192APromoterhSyn (human synapsin I promoter)Available sinceAvailabilityAcademic Institutions and Nonprofits only -
pFSW Syt1-C2A M173,F234A IRES GFP
Plasmid#133825PurposeEncodes the C2A domain of synaptotagmin 1 with membrane-penetrating residue mutations M173,F234A for viral expressionDepositorInsertSyt1 (Syt1 Rat)
UseLentiviralTagsIRES-GFPExpressionMutationM173, F234APromoterhSyn (human synapsin I promoter)Available sinceAvailabilityAcademic Institutions and Nonprofits only -
Tol2-kdrl:mCherry-caax
Plasmid#194287PurposeExpression plasmid for zebrafish or Danionella cerebrumDepositorInsertkdrl promoter from Addgene plasmid # 78687 (kdrl Zebrafish)
UseZebrafish or danionella cerebrum expressionTagsmCherryCAAX from the Tol2kit (Kwan et al., 2007)ExpressionMutationPromoterkdrl(flk1)Available sinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pePEmax-pPuro
Plasmid#215688PurposeCloning vector for Uni-Vector prime editing systemDepositorInsertPEmax
UseUnspecifiedTagsExpressionMutationPromoterEFS promoterAvailable sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SNAI2_P2A_Hygro_Barcode
Plasmid#120478PurposeBarcoded lentiviral vector to express SNAI2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertSNAI2 (SNAI2 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AWP-029
Plasmid#213966PurposeExpresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for gRNA constitutive expression.DepositorInsertCas12a (cas12a Synthetic, Segatella bryantii)
UseTags3XFLAGExpressionBacterialMutationD875A to inactivate target nuclease activityPromoterPcfxA, IPTG inducibleAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYCL_P2A_Hygro_Barcode
Plasmid#120462PurposeBarcoded lentiviral vector to express MYCL in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYCL (MYCL Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
UseTagsExpressionInsectMutationPromoterAvailable sinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PARP1-Flag-His-WT
Plasmid#111572PurposeExpresses full length PARP1 in Sf9 (insect) cellsDepositorInsertPARP1 (PARP1 Human)
UseTagsC-terminal 6xHis and C-terminal FlagExpressionInsectMutationPromoterpolyhedrin promoterAvailable sinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNvT-MHC::mCh
Plasmid#67943PurposeTransgenesis vector consisting of a 1.6-kb fragment of MyHC1 promoter region upstream of the start codon and an mCherry reporter gene, flanked by inverted binding sites of meganuclease I-SceIDepositorInsertmCherry
UseTransgenic reporter in the sea anemone, nematoste…TagsExpressionMutationPromoterMyosin Heavy Chain1 (MyHC1)Available sinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKan-PRFA1-9myc-AID*(N)
Plasmid#99528PurposeN-terminal 9myc-AID* degron cassette with RFA1 promoter and KanR marker for S. cerevisiaeDepositorInsertIAA17(71-117) (AXR3 Mustard Weed)
UsePcr template for yeast tagging cassetteTags9xMycExpressionMutationPromoterRFA1Available sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
AWP-031
Plasmid#213967PurposeExpresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for constitutive CRISPR array expression.DepositorInsertCas12a (cas12a Synthetic, Segatella bryantii)
UseTags3XFLAGExpressionBacterialMutationD875A to inactivate target nuclease activityPromoterPcfxA, IPTG inducibleAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKan-PCUP1-9myc-AID*(N)
Plasmid#99527PurposeN-terminal 9myc-AID* degron cassette with CUP1 promoter and KanR marker for S. cerevisiaeDepositorInsertIAA17(71-117) (AXR3 Mustard Weed)
UsePcr template for yeast tagging cassetteTags9xMycExpressionMutationPromoterCUP1Available sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
BtuF
Plasmid#92209PurposeExpression of BtuF which is the vitamin B12 binding protein for BtuCD ABC TransporterDepositorInsertBtuF (btuF )
UseTags6x His Tag and PelB Signal SequenceExpressionBacterialMutationBtuF signal sequence removed and uses the PelB si…PromoterT7 PromoterAvailable sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGM32DEST
Plasmid#74747PurposeEncodes for the QF-GR recombinant gene, splice linker, and mCherry reporter geneDepositorInsertsUseTagsFusion of the Neurospora crassa QF activator to t…ExpressionWormMutationPromoterNo promoterAvailable sinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a_OTX2_P2A_Hygro_Barcode
Plasmid#120471PurposeBarcoded lentiviral vector to express OTX2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertOTX2 (OTX2 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SRY_P2A_Hygro_Barcode
Plasmid#120485PurposeBarcoded lentiviral vector to express SRY in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertSRY (SRY Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKan-PCUP1-AID*(N)-9myc
Plasmid#99526PurposeN-terminal AID*-9myc degron cassette with CUP1 promoter and KanR marker for S. cerevisiaeDepositorInsertIAA17(71-116) (AXR3 Mustard Weed)
UsePcr template for yeast tagging cassetteTags9xMycExpressionMutationPromoterCUP1Available sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_PAX7_P2A_Hygro_Barcode
Plasmid#120472PurposeBarcoded lentiviral vector to express PAX7 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertPAX7 (PAX7 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SOX3_P2A_Hygro_Barcode
Plasmid#120481PurposeBarcoded lentiviral vector to express SOX3 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertSOX3 (SOX3 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
HC078 (3xHA-Atg13)
Plasmid#59544PurposeExpresses yeast Atg13 under the endogenous promoter with a 3xHA N-terminal tagDepositorInsertATG13 (ATG13 Budding Yeast)
UseTags3xHAExpressionBacterial and YeastMutationAvrII site created after start codonPromoterATG13Available sinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a_ONECUT1_P2A_Hygro_Barcode
Plasmid#120470PurposeBarcoded lentiviral vector to express ONECUT1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertONECUT1 (ONECUT1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYOG_P2A_Hygro_Barcode
Plasmid#120465PurposeBarcoded lentiviral vector to express MYOG in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYOG (MYOG Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SIX1_P2A_Hygro_Barcode
Plasmid#120476PurposeBarcoded lentiviral vector to express SIX1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertSIX1 (SIX1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_NEUROG1_P2A_Hygro_Barcode
Plasmid#120467PurposeBarcoded lentiviral vector to express NEUROG1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertNEUROG1 (NEUROG1 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Aldh1a1-HA-WPRE-HGHpA
Plasmid#184633PurposeExpresses Aldh1a1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorInsertAldh1a1 (Aldh1a1 Mouse)
UseAAVTagsExpressionMutationPromoterEF1aAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-PM
Plasmid#111271Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation (Syk Mouse)
UseTagsExpressionBacterialMutationY130E mutation to mimic phosphorylationPromoterT7 promoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Munc18b
Plasmid#135554PurposeExpress rat Munc18b in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Munc18b.DepositorInsertMunc18b (Stxbp2 Rat)
UseTags6xHis tag and TEV siteExpressionInsectMutationPromoterpolyhedrin promoterAvailable sinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
cARA12-mRFP
Plasmid#181961PurposeARA12 protein tagged with mRFP, under control of TBA2 promoterDepositorInsertARA12 (ARA12 Mustard Weed)
UseTagsmRFPExpressionPlantMutationPromoterTBA2Available sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL3
Plasmid#184131PurposeFor rescuing null mrp-1 mutation and labelling mrp-1 protein. Intestinal specific Pges-1 promoter drives MRP-1 expression. Translational fusion construct. pPD95.75_Pges-1::mrp-1(isoform C cDNA)::gfp.DepositorInsertMRP-1 (mrp-1 Nematode)
UseTagsGFPExpressionWormMutationPromoterPges-1 (3.3kb)Available sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAN1-aa1-150
Plasmid#65412PurposeRCAN1 aa1-150 expression with CMV promoter. Flag tagged.DepositorInsertRCAN1-aa1-150 (Rcan1 Mouse)
UseTagsFlagExpressionMammalianMutationaa1-150 present, deleted 151 to endPromoterAvailable sinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235297PurposeComMAND open-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235298PurposeComMAND closed-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available sinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2-bGH
Plasmid#235296PurposeComMAND base gene regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
UseTagsExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…PromoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFsynW SYT1-PGM reporter
Plasmid#197278PurposeEncodes for viral expression of Synaptotagmin 1 (SYT1) for use in the RUSH system; visualized with HaloTag. Reporter only (no hook). SYT1 is mutated to disrupt palmitoylation and glycosylation.DepositorInsertSYT1 and HaloTag (Syt1 Rat)
UseLentiviralTagsFLAGExpressionMutationT15A, T16A, N24Q, C74A, C75A, C77A, C79A, and C82APromoterhSyn (human synapsin I promoter)Available sinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 PhoP-Salmonella enterica subsp. enterica serovar Typhimurium, Synthetic)
UseTagsmNeonGreenExpressionBacterialMutationPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only