We narrowed to 8,284 results for: crispr grnas
-
Plasmid#105587Purposelentivirally express gRNA targeting ROSA26 locus with GFP marker and neo resistanceDepositorInsertgRNA targeting rosa26 locus
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
SP_gRNA_pUC19_N_FancF_Left
Plasmid#79892PurposeHuman gRNA expression vector targeting FANCF (site 1 left)DepositorInsertFancF_Site_1_Left
UseCRISPRTagsNoneAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP1187
Plasmid#119256Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgp27#1
Plasmid#102759PurposeExpresses sgRNA targeting mouse p27DepositorAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -126
Plasmid#50924PurposeU6 driven sgRNA targeting Sox17 -126 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN286
Plasmid#91669PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN023
Plasmid#91671PurposeExpress sgRNA targeting human SYNGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN024
Plasmid#91672PurposeExpress sgRNA targeting human SYNGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN144
Plasmid#91673PurposeExpress sgRNA targeting human TBC1D5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN145
Plasmid#91674PurposeExpress sgRNA targeting human TBC1D5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN216
Plasmid#91675PurposeExpress sgRNA targeting human TLE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN218
Plasmid#91677PurposeExpress sgRNA targeting human TLE3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN219
Plasmid#91678PurposeExpress sgRNA targeting human TLE3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN177
Plasmid#91628PurposeExpress sgRNA targeting human IDO2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN269
Plasmid#91632PurposeExpress sgRNA targeting human KCNB1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN196
Plasmid#91641PurposeExpress sgRNA targeting human MEF2CDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only