We narrowed to 19,203 results for: IRE
-
Plasmid#186339PurposeExpress Trim41-PA-1D4 under the mouse Clgn promoter.DepositorAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-Myc-His RTN3A1
Plasmid#31087DepositorAvailable SinceAug. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(2)-T2A-3X Gal80-Hsp70
Plasmid#62953PurposeCreating Gal80 lines from MiMIC lines with inserts into coding introns in Phase 1. Gal80 is tagged with FLAG, HA and EGFP.DepositorInsert3XGal80-FLAG/HA/EGFP-Hsp70
Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA
Plasmid#153530PurposeUsed as a donor vector for the targeted correction of a mutation in PIGA exon 6DepositorInsertPIGA (a 1,991-bp fragment from intron 5 and exon 6)
UseDonor plasmidTagsN/AMutationNo mutationPromoterNo promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-AP1/gamma1
Plasmid#218801PurposeMammalian expression of mouse Ap1 g1DepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(2)-T2A-Gal4-Hsp70
Plasmid#62898PurposeCreating Gal4 drivers from MiMIC lines with inserts into coding introns in Phase 2.DepositorInsertT2A-Gal4-Hsp70
Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGREAT1
Plasmid#170889PurposeGoldenBraid Double Transcriptional Unit - pNOS_E-Luc_NOSt+pNOS_Red-F_NOStDepositorInsertE-Luc
UseLuciferase and Synthetic BiologyExpressionPlantMutationc.375C>T silent mutation to remove BbsI site (…PromoterpNOSAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-erHRP(N175S mutant)
Plasmid#79909PurposeerHRP(N175S mutant) pCMV backboneDepositorInserterHRP(N175S mutant)
TagsHA tagExpressionMammalianMutationN175S mutationPromoterCMVAvailable SinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CRY2-mCh-superPLDx10
Plasmid#188986PurposeA lentiviral plasmid encoding CRY2-mCh-superPLDx10 (an engineered PLD mutant with 10 times higher activity than the wild-type)DepositorInsertPLD
TagsCRY2 and mCherryExpressionMammalianMutationF163L, K249R, G328S, G381V, G429D, D480GPromoterCMVAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70
Plasmid#62915PurposeCreating p65AD hemidrivers from MiMIC lines with inserts into coding introns in Phase 2DepositorInsertT2A-p65AD-Hsp70
Available SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-30
Plasmid#172754PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-30; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-30
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(0)-T2A-Gal4DBD-Hsp70
Plasmid#62902PurposeCreating Gal4DBD hemidrivers from MiMIC lines with inserts into coding introns in Phase 0DepositorInsertT2A-Gal4DBD-Hsp70
Available SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(1)-T2A-3X Gal80-Hsp70
Plasmid#62952PurposeCreating Gal80 lines from MiMIC lines with inserts into coding introns in Phase 1. Gal80 is tagged with FLAG, HA and EGFP.DepositorInsert3XGal80-FLAG/HA/EGFP-Hsp70
Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSL0915 (CRISPR with target 3)
Plasmid#130643PurposeExpresses CRISPR RNA from a T7 promoter for VchCAST system. The CRISPR array encodes a guide RNA that targets lacZ.DepositorInsertCRISPR(target-3)
UseCRISPR; TransposonExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI CMV GFP TREX1 R128A R174A BLAST
Plasmid#164234Purposelentiviral plasmid for GFP-TREX1 R128A R174ADepositorInsertTREX1 (TREX1 Human)
UseLentiviralTagsGFPExpressionMammalianMutationR124A R174APromoterCMVAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-EGFP-ULK1(K46N)
Plasmid#38197DepositorInserta novel protein kinase structurally related to C. elegans UNC-51 (Ulk1 Mouse)
UseRetroviralTagsEGFPExpressionMammalianMutationchanged Lysine 46 to AsparagineAvailable SinceAug. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
shLacZ
Plasmid#42559DepositorInsertshLacZ
UseLentiviral and RNAiExpressionMammalianAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO mouse shRNA 2 raptor
Plasmid#21340DepositorAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-hsDicer (D1709A)
Plasmid#41588DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-41-4GS-LaG-2
Plasmid#172766PurposeBacterial expression of dimerized anti-GFP nanobodies LaG-41 and LaG-2 (4GS linker)DepositorInsertLaG-41-4GS-LaG-2
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIVT/Smarca4
Plasmid#122146PurposeFor making Smarca4 RNADepositorAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs_NMNAT3-FLAG
Plasmid#133261PurposeExpress FLAG-tagged NMNAT3 in mammalian cellsDepositorAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTRY-YFP
Plasmid#15302DepositorInsertYFP
UseGateway entryAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-HEPN
Plasmid#75296PurposeExpresses Sacsin HEPN domain (4441-4579) in fusion with GST (bacterial)DepositorInsertHuman Sacsin 4441-4579
TagsGST-TagExpressionBacterialAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_VP11H
Plasmid#188063PurposePROSS-designed versatile peroxidase 11HDepositorInsertPROSS-designed versatile peroxidase from Pleurotus ostreatus
TagsS. cerevisiae native α-factor prepro-leader signa…ExpressionYeastMutation38 PROSS mutations, described in publicationAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMALB
Plasmid#161784PurposeGateway destination vector with bidirectional CMV-PGK promoter for modest expression of gene of interest and TagBFP.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterBidirectional minhCMV and hPGKAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ago1
Plasmid#21533DepositorAvailable SinceJuly 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMAL
Plasmid#161783PurposeGateway destination vector with bidirectional CMV-PGK promoter for modest expression of gene of interest and GFP.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterBidirectional minhCMV and hPGKAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAGH42
Plasmid#107249PurposeVipp1-mGFPmut3 (or vipp1-gfp) construct with spectinomycin resistance cassette downstream used to replace the native copy of Vipp1 in Synechocystis (sll0617).DepositorInsertvipp1-gfp
UseSuicide vector for destined for double homologous…TagsmGFPmut3ExpressionBacterialPromoternative promoter of sll0617Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag16-fibcon-iCAM1
Plasmid#205212PurposeThis vector encodes of the synCAM (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pISH-Gap43
Plasmid#74336PurposeUse to synthesize riboprobes for in situ hybridization (ISH) probe for Gap43. Not for gene expression.DepositorInsertgrowth associated protein 43 (Gap43 Mouse)
Available SinceMay 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-18
Plasmid#172763PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-18; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-18
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(1)-T2A-LexA::QFAD-Hsp70
Plasmid#62948PurposeCreating LexA::QF drivers from MiMIC lines with inserts into coding introns in Phase 1DepositorInsertT2A-LexA::QFAD-Hsp70
Available SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-Dmrt1
Plasmid#41083DepositorAvailable SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CRY2-mCh-superPLDx30
Plasmid#188988PurposeA lentiviral plasmid encoding CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type)DepositorInsertPLD
TagsCRY2 and mCherryExpressionMammalianMutationK109R, P245A, G328S, G381V, G429DAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3
Plasmid#62957PurposeTriplet donor for in vivo RMCE with MiMIC inserts to make Gal4 driver.DepositorInsertT2A-Gal4 in three phases
Available SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SPIB_P2A_Hygro_Barcode
Plasmid#120483PurposeBarcoded lentiviral vector to express SPIB in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUWR-Cad-Venus
Plasmid#58328PurposeDestination vector for inserting ubi-Cad-Venus to Drosophila melanogaster genomeDepositorInsertCad-Venus
ExpressionInsectPromoterpoly-ubiquitinAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-10
Plasmid#172743PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-10; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-10
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pCPP5238
Plasmid#128711PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopG1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS-KLF7-200-GFPfr1
Plasmid#169799PurposeTHe donor vector for the KLF7 gene locus.DepositorInsertDonor sequence to KLF7 neighbouring region for HR
UseHr donor vector for human actb gene.MutationPartial sequence of GFP is inserted the sequence …Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
WT (REP10)
Plasmid#21368DepositorInsertautosomal dominant polycystic kidney disease type I (PKD1 Human)
ExpressionMammalianAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-42
Plasmid#172758PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-42; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-42
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Krox20 promoter pGL3-TATA
Plasmid#21260DepositorAvailable SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRcCMV Cep164 (Nigg CW325)
Plasmid#41148DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK-Cas9-gate
Plasmid#113743PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving aminoglycoside phosphotransferase for G418 selection in plants.DepositorInsertCas9
UseCRISPR; Gateway destination vectorPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only