We narrowed to 8,434 results for: Dos
-
Plasmid#73455PurposeExpress human middle part (Q513-E784) Plekhm1 in mammalian cellsDepositorAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pMpGWB417
Plasmid#68682PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB420
Plasmid#68685PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB425
Plasmid#68690PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsTriple repeats of Citrine (3xCitrine)ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB317
Plasmid#68645PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB220
Plasmid#68611PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
p5A3-T
Plasmid#92019PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N-terminal TEV cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pBS-Cx43
Plasmid#65439PurposeCloning, T7 RNA expressionDepositorAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFusX4-31
Plasmid#63440PurposeEncodes RVD positions 10-12 in TALEN assemblyDepositorInsertHD NG NN
UseTALENMutationnoneAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pSMP-NR2F1_1
Plasmid#36362DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 - human TUBB6 Cterminal tail
Plasmid#60403PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta5 tubulin Cterminal tail (TUBB6) using a GAL promoterDepositorInsertTUB2
ExpressionYeastMutationTUB2 amino acids 429 - end, replaced with human T…PromoterGALAvailable SinceMay 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
FRIG-myc-Sema4DdeltaC
Plasmid#51607Purposeexpresses myc-tagged Sema4D lacking C terminus in lentiviral backboneDepositorInsertSema4DdeltaC (Sema4d Mouse)
UseLentiviralTagsmyc tagExpressionMammalianMutationdeleted last 70 amino acids in the C-terminusPromoterRSVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLP110_AAV Scramble Control
Plasmid#239419PurposeNegative control AAV vector for SaCas9-based CRISPR KODepositorInsertScramble control
UseAAVAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP857_α-syn:oScarlet KI donor
Plasmid#239403PurposeAAV vector for SpCas9-mediated CRISPR KI of oScarlet at the C-terminus of mouse α-synDepositorInsertoScarlet
UseAAV and CRISPRTagsoScarletExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-Pmyc-ccw
Plasmid#158027PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains a MYC promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterMYCAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc
Plasmid#158028PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R1-R2).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hSTARR-luc-ccw
Plasmid#158029PurposeThis is a dual function destination vector for eSTARR-seq and luciferase assay to quantify enhancer activity. It contains an SCP1 promoter, a luciferase CDS, followed by a Gateway cassette (R2-R1).DepositorTypeEmpty backboneUseLuciferaseExpressionMammalianPromoterSCP1 (Super Core Promoter 1)Available SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only