We narrowed to 917 results for: tac promoter
-
Plasmid#49990Purposeexpresses an attenuated T7 RNAP under an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible controlDepositorInsertT7 RNAP*
UseSynthetic BiologyTagsumuD degradation tagExpressionBacterialMutationR632SPromoterpTac-symmetricAvailable SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Dual_pegRNA
Plasmid#173200PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGEX-6P1-hNF2-AR mutant
Plasmid#107149Purposebacterial expressionDepositorInsertneurofibromin 2 (NF2 Human)
UseTagsGSTExpressionBacterialMutationA585W-R588KPromoterPtacAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
XLone-UCE mutant
Plasmid#242185PurposeExpress doxycycline inducible UCE 32S binding mutation of CRNDE in mammalian cellsDepositorInsertCRNDE UCE mutant (CRNDE Human)
UseTagsExpressionMammalianMutationATTTTCATGGGC to TAAAAGTACCCGPromoterTRE3GSAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW263 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R(FLP-IN)
Plasmid#236126PurposePlasmid encoding ADAR2dd attached to PUF-9R under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Human, Synthetic)
UseTagsExpressionMammalianMutationE488Q, T501A in ADAR2ddPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW499 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(N2093W, T2098L)
Plasmid#236146PurposePlasmid encoding the NZF transcriptional activation domain attached by a deimmunized linker to FRB with N2093W and T098L mutations, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
UseTagsExpressionMammalianMutationN2093W, T2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pZ8-T_dCas9
Plasmid#74062PurposepZ8-1 plasmid carrying dcas9, driven by the IPTG-inducible Ptac promoter, KanRDepositorInsertdcas9
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterptacAvailable SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBRα
Plasmid#53731PurposePlpp/PlacUV5 -directed synthesis of E. coli RNAP alpha subunit; used as two-hybrid control. For cloning purposes, see Addgene plasmid 53734.DepositorInsertαNTD
UseTagsExpressionBacterialMutationPromoterlpp/lacUV5 (tandem promoter)Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
VV221: sdChR(C138S)-TS-eGFP-ER in fck
Plasmid#58513PurposeExpresses sdChR with the C138S (step function opsin) mutation fused to eGFP under the a-CamKII promoterDepositorInsertsdChR(C138S)-TS-eGFP-ER
UseLentiviralTagseGFPExpressionMammalianMutationchanged Cysteine 138 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-1
Plasmid#193694PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagExpressionMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-ATRX ADD
Plasmid#59698PurposeContains histone modification interacting domain (ATRX ADD)DepositorAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-KDM4A double Tudor
Plasmid#59699PurposeContains histone modification interacting domain (KDM4A double Tudor)DepositorInsertKDM4A double Tudor (KDM4A Human)
UseTagsGSTExpressionBacterialMutationPromotertac promoterAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNSSCPG
Plasmid#183187PurposePACE-evolved split N (core) terminal of T7 RNA polymerase-SpmXΔC and SpmXΔC-PACE-evolved split C (sigma) terminal of T7 RNA polymerase both expressed under Tac promoter; sfGFP-LAA expressed under T7 pDepositorInsertssuperfolder GFP
SpmX450 and T7 181+ fusion protein
T7 RNAP 1-179 variant and SpmX450 fusion protein
mRFP1 and popZ fusion protein
UseTagsExpressionBacterialMutationPromoterAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1_WT RAD23A
Plasmid#201456PurposeExpresses human RAD23A with an N-terminal GST tag in E. coliDepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsGSTExpressionBacterialMutationCoding sequence has been optimised for expression…Promotertac promoterAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-CBX1 Chromo
Plasmid#59697PurposeContains histone modification interacting domain (CBX1 Chromo)DepositorAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only