We narrowed to 13,951 results for: CRISPR-Cas9
-
Plasmid#191015PurposeCRISPR vector based on Aspergillus flavus U6 promoter and terminator for targeting the yA gene, which contains AMA1(the HindIII-PstI fragment) and ptrA selection marker.DepositorInsertyA
UseCRISPRPromoterAspergillus flavus U6Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
Plasmid#164471PurposeExpresses sgRNA targeting human GJA1 locusDepositorAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
Plasmid#87917PurposeGateway cloningDepositorInsertsgHTT1, sgGFP2, shCas9
ExpressionMammalianPromoterH1, U6, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-Dn29-dCas9-P2A-GFP
Plasmid#247155PurposeMammalian expression of a human codon optimized wildtype Dn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_on-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233373PurposeEF1α driven co-expression of the consitutively active kinase activity recorder positive control Kinprola_on fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_on-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_PKA_T/A-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233372PurposeEF1α driven co-expression of the inactive PKA activity recorder negative control with T/A mutation Kinprola_PKA_T/A fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_PKA_T/A-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ENL)
Plasmid#69212PurposeLentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; MLL-ENL,(t[11;19])DepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide
Plasmid#246438PurposeAll-in-one plasmid. Expresses R-NmeCas9 in mammalian cells for RNA knockdown. Spacer targeting EZH2 gene.DepositorInsertsNmeCas9
Nme-sgRNA
TagsHA tag, NLS, and SV40 NLSExpressionMammalianMutationchanged Aspartic acid 16 to Alanine, deleted amin…PromoterEF-1 alpha and U6Available SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLR5-CBh-dCas9-hUtx-IRES-Hyg
Plasmid#122374PurposeExpresses dCas9-hUtx-IRES-Hyg in mammalian cellsDepositorInsertCBh-dCas9-hUtx-IRES-Hyg-pA
UsePiggybacExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLR5-CBh-dCas9-hEzh2-IRES-Hyg
Plasmid#122375PurposeExpresses dCas9-hEzh2-IRES-Hyg in mammalian cellsDepositorInsertCBh-dCas9-hEzh2-IRES-Hyg-pA
UsePiggybacExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAT1089-(PB-4_EF1α-Blast_2A_rtTA3 [HA-NLS-dCas9-NLS])
Plasmid#251108PurposeExpression of dCas9 component of Casilio-i systemDepositorInsertdCas9
TagsHAExpressionMammalianMutationN/AAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IB801: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-KRAB
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only