We narrowed to 42,125 results for: TRO
-
Plasmid#224741PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724A mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 to AlaninePromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724D
Plasmid#224742PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724D mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 Aspartate; Valine 53 Iso…PromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2088-Mut-GPA-NLuc-Biosensor-Retrovirus-TD138
Plasmid#222876PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). Mixed WT/V84R Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(V84R)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianMutationFRB chain: V84R in GPAPromoterMSCV LTRAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform E (codon optimized)
Plasmid#199570PurposeStable and dox. inducible expression of Trim69 isoform E (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform E (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform D (codon optimized)
Plasmid#199569PurposeStable and dox. inducible expression of Trim69 isoform D (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform D (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform C (codon optimized)
Plasmid#199568PurposeStable and dox. inducible expression of Trim69 isoform C (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform C (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Utrophin-GFP-U6ac-Rac2 guides
Plasmid#168254Purpose"label stable F-actin under Rac2 neutrophil-specific knockout background"DepositorInsertUtrophin-GFP
UseZebrafish expressionPromoterLyzCAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP209-Lenti-1.3CaMKII P-Intron-Flag-GluN2A-WPRE-pA
Plasmid#74714PurposepLenti vector backbone designed to express Flag-GluN2A from a 1.3CaMKII promoter. Transgene in reverse orientation.DepositorInsertFlag-GluN2A
UseLentiviralTagsFlagPromoter1.3CaMKIIaAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Utrophin-GFP-U6ac-ctrl guides
Plasmid#168253Purpose"label stable F-actin; control for neutrophil-specific knockout"DepositorInsertUtrophin-GFP
UseZebrafish expressionPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-sfGFP+HsbG syntron
Plasmid#172477PurposesfGFP with a synthetic intron derived from the human beta-globin geneDepositorInsertsfGFP
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-sfGFP+pCI syntron
Plasmid#172478PurposesfGFP with a synthetic intron from the pCI expression vector (Promega)DepositorInsertsfGFP
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-sfGFP+MmIghe syntron
Plasmid#172475PurposesfGFP with a synthetic intron derived from the mouse Ighe geneDepositorInsertsfGFP
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-sfGFP+RbG syntron
Plasmid#172476PurposesfGFP with a synthetic intron derived from the rabbit beta-globin geneDepositorInsertsfGFP
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-control-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128347PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorInsertcontrol (negative)
UseCRISPRExpressionMammalianAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
BFP-GFP-bidirectional MS2 splicing reporter CORO1B intron
Plasmid#235086PurposeGFP splicing reporter with CORO1B intronDepositorInsertBFP-GFP-bidirectional MS2 splicing reporter CORO1B intron (CORO1B Human)
UseAAVExpressionMammalianPromotercustom bidirectionalAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BFP-GFP-bidirectional MS2 splicing reporter FRG1-intron
Plasmid#235087PurposeGFP splicing reporter with FRG1 intronDepositorInsertBFP-GFP-bidirectional MS2 splicing reporter FRG1-intron (FRG1 Human)
UseAAVExpressionMammalianPromotercustom bidirectionalAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1
Plasmid#184395PurposeDonor plasmid for stable integration of firefly luciferase control reporter at AAVS1DepositorInsertFirefly luciferase beta-globin
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianPromoterTet-On 3GAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET LIC cloning vector with BioBrick polycistronic restriction sites (9A)
Plasmid#48283DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1
Plasmid#184396PurposeDonor plasmid for stable integration of Renilla luciferase control reporter at AAVS1DepositorInsertRenilla luciferase beta-globin
UseCRISPR; Donor plasmid for hdrTags3X FLAGExpressionMammalianPromoterTet-On 3GAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV 5TOP intron renilla TRICK CTE polyA
Plasmid#64544Purpose5′ TOP TRICK reporter mRNADepositorInsert12x PP7 stem-loops
Tags24xMS2 stem loops, 5' TOP (5′ terminal oligo…ExpressionMammalianPromoterTetracycline-inducible promoter and 5′ UTR of hum…Available SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I acceptor only control (F40-based tension sensor)
Plasmid#119189PurposeThe acceptor (mEYFP) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration or with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin I-[mTFP1(Y72G)-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I donor only control (F40-based tension sensor)
Plasmid#119188PurposeThe donor (mTFP1) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration and provides the donor only lifetime to determine FRET efficiency.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP(Y67G)] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Control click editor - pCMV-T7-deadPCV2-nCas9-EcKlenow (EMK492)
Plasmid#208943PurposeA control CE1 construct with catalytically attenuated PCV2 HUH, expressed from CMV or T7 promoters.DepositorInsertdPCV2-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPCV2(Y96F); nSpCas9(H840A); EcKlenow(-exo;D355A/E…PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Control click editor - pCMV-T7-PCV2-deadCas9-EcKlenow (EMK500)
Plasmid#208944PurposeA control CE1 construct with catalytically inactivated SpCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-dSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationdSpCas9(D10A/H840A);EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-tdTomato+RbG and HsbG syntrons
Plasmid#172479PurposetdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInserttdTomato
UseCre/LoxExpressionMammalianAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2211 - [1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
Plasmid#159866PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(intron, PATC, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Control click editor - pCMV-T7-PCV2-nCas9-deadEcKlenow (JO520)
Plasmid#208945PurposeA control CE1 construct with catalytically attenuated EcKlenow DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-dEcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A);deadEcKlenow(-exo;D355A,D357A,D705…PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based tension sensor)
Plasmid#118717PurposeThe donor (YPet(short)) only control for the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-F40-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based tension sensor)
Plasmid#118719PurposeThe acceptor (mCherry) only control for the F40-based human desmoplakin II tension sensor can be co-expressed with the donor (YPet(short)) only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II-[YPet(short)(Y67G)-F40-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)(Y67G)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG) matched positive control in pTwist-CMV
Plasmid#216156PurposeExpresses mScarlet regardless of TDP-43 knockdown. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB-NLS_T2A_EGFP (Y67X)_LNMA intron
Plasmid#246435PurposeExpresses inactive EGFP (Y67X) in mammalian cells for trans-splicing assessments. LMNA intron is inserted into EGFP CDS.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
EGFP
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBac LIC cloning vector with BioBrick polycistronic restriction sites (11A)
Plasmid#48294DepositorTypeEmpty backboneExpressionInsectAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 TEV cloning vector with BioBrick polycistronic restriction sites (9B)
Plasmid#48284DepositorTypeEmpty backboneTagsHis6ExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET StrepII TEV cloning vector with BioBrick polycistronic restriction sites (9R)
Plasmid#48290DepositorTypeEmpty backboneTagsStrepIIExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 Full length, isoform A (codon optimized)
Plasmid#199566PurposeStable and dox. inducible expression of Trim69 Full length, isoform A (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 Full length, isoform A (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET FLAG TEV cloning vector with BioBrick polycistronic restriction sites (9L)
Plasmid#48288DepositorTypeEmpty backboneTagsFLAGExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSRG11 (eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR)
Plasmid#245121PurposeOptimized SunTag antibody for expression in C. elegans. Useful for visualization of translation of GCN4 encoding mRNAs or for visualization of GCN4-tagged proteinsDepositorInsertseft-3p
scFv (GLO)
GFP (GLO)
tbb-2 3'UTR
left recombination arm MosSCI ttTi5605
right recombination arm MosSCI ttTi5605
ExpressionBacterial and WormAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Zeo(+)_TKIT NFL intron3/exon4 linker(WT)-3xFLAG donor
Plasmid#182682PurposeContains a donor sequence with a part of Nefl intron 3, whole Nefl exon 4 and linker-3xFLAG. Used as a donor for endogenous NFL tagging via Targeted Knock-In with Two guides (TKIT) approach.DepositorInsertmouse Nefl intron3-exon4-linker(WT)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterNAAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Zeo(+)_mCherry_TKIT NFL intron3/exon4 linker(WT)-3xFLAG donor
Plasmid#182685PurposeEncodes mCherry and contains a donor sequence with a part of Nefl intron 3, whole Nefl exon 4 and linker-3xFLAG. Can be used as a donor plasmid for the tagging of endogenous NFL via TKIT approach.DepositorInsertsExpressionMammalianPromoterCMV and NAAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET MYFQSNA tagged cloning vector with BioBrick polycistronic restriction sites (9U)
Plasmid#48293DepositorTypeEmpty backboneTagsMYFQSNAExpressionBacterialAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFastBac His6 TEV cloning vector with BioBrick polycistronic restriction sites (11B)
Plasmid#48295DepositorTypeEmpty backboneTagsHis6ExpressionInsectAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ control UTRs
Plasmid#67929PurposeTranslational reporter - control UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralExpressionMammalianAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Sumo TEV cloning vector with BioBrick polycistronic restriction sites (9S)
Plasmid#48291DepositorTypeEmpty backboneTagsHis6 and SumoExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Thioredoxin TEV cloning vector with BioBrick polycistronic restriction sites (9T)
Plasmid#48292DepositorTypeEmpty backboneTagsHis6 and ThioredoxinExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 MBP TEV cloning vector with BioBrick polycistronic restriction sites (9C)
Plasmid#48286DepositorTypeEmpty backboneTagsHis6 and MBPExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Mocr TEV cloning vector with BioBrick polycistronic restriction sites (9O)
Plasmid#48289DepositorTypeEmpty backboneTagsHis6 and MocrExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Zeo(+)_TKIT NFL intron3/exon4 linker(TAG)-3xFLAG donor
Plasmid#182686PurposeContains a donor sequence with a part of Nefl intron 3, whole Nefl exon 4 and linkerA6TAG-3xFLAG. Can be used as a donor for the tagging of endogenous NFL via TKIT approach and click labeling of NFL.DepositorInsertmouse Nefl intron3-exon4-linker(TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterNAAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc)
Plasmid#48285DepositorTypeEmpty backboneTagsHis6ExpressionBacterialAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV intron 20xGCN4 Renilla FKBP Stop 24xMS2v5 SV40 CTE polyA
Plasmid#119945PurposeExpresses SunTag-Renilla mRNA reporter in mammalian cells; note plasmid contains 24xGCN4 repeatsDepositorInsertRenilla luciferase
Tags24xGCN4 repeats (SunTag), 24xMS2v5 stem loops in …ExpressionBacterial and MammalianPromoterTetCMVAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only