We narrowed to 27,324 results for: sta
-
Plasmid#227094PurposeLuciferase reporter vector with MMTV 5' Element cloned downstream of luciferase gene in pHMRΔelucDepositorInsertMMTV insert spanning from R region to 400 bp of Gag
UseLuciferaseAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
act-3p(long):rfp
Plasmid#202330PurposeThe act-3 promoter drives expression of TurboRFP in the pharynx, spermatheca, and body wall of C. elegans.DepositorInsertsact-3p(long) promoter
TurboRFP
ExpressionWormPromoterThis is a promoter sequence for C. elegans act-3 …Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.a_pSTC0-zeo
Plasmid#202347PurposeDesign opt.a (greedy optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.a
Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.b_pSTC0-zeo
Plasmid#202348PurposeDesign opt.b (parallel tempering optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.b
Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_052
Plasmid#216082Purposefor stable fly cell lines; Hygromycin resistance gene; for genome integration by spontaneous insertion, destination vectorDepositorHas ServiceCloning Grade DNAInsertHygromycin resistance gene
UseDestinationExpressionInsectAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SF3B3
Plasmid#156003PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
ptAD-seq-ubi63E-Gal4-DBD
Plasmid#111930PurposeVector to express tAD candidates from a library cloned from fragmented transcription factor coding sequences fused to the Gal4 DNA binding domain.DepositorInserttAD-seq Gal4-DBD
ExpressionInsectAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1D
Plasmid#196686PurposeRep/Cap plasmid for the production of PAL1D, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTFR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.1
Plasmid#196687PurposeRep/Cap plasmid for the production of M.Fas.1, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationTDALTTK insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1B
Plasmid#196684PurposeRep/Cap plasmid for the production of PAL1B, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPSQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1A
Plasmid#196683PurposeRep/Cap plasmid for the production of PAL1A, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.4
Plasmid#196690PurposeRep/Cap plasmid for the production of M.Fas.4, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationVVSDYTV insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.3
Plasmid#196689PurposeRep/Cap plasmid for the production of M.Fas.3, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRVDPSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.2
Plasmid#196688PurposeRep/Cap plasmid for the production of M.Fas.2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationSTIPTMK insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP793_L2_V05_s35S_AND_GFP_pOp6_Flp_CO2_B3
Plasmid#192397PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when its AND gate unit is activated by both cell type (cortex) and chemical induction (by DEX).DepositorInsert35S::FRT-OCS-FRT::B3RT-OCS-B3RT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only