We narrowed to 5,529 results for: crispr cas9 grna plasmid
-
Plasmid#172224PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the telomeric human NANOG CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-HF-tetra-com-vector
Plasmid#132555PurposeVector plasmid expressing high fidelity spCas9 (R691A) and sgRNA scaffold with com replacing the Tetraloop.DepositorInsertsHigh fidelity Cas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tubb3gRNA-mCherry
Plasmid#87111Purposemouse Tubb3 target gRNA expression plasmid with CAGmCherryDepositorInsertMouse Tubb3 gRNA
UseCRISPRPromoterCAGAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
p206_LTJ_sgRNACD45.2_R3
Plasmid#82674PurposesgRNA targeting murine CD45.2 region 3. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting CD45.2 region 3
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p202_LTJ_sgRNACD45.2_R1
Plasmid#82672PurposesgRNA targeting murine CD45.2 region 1. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD45.2 region 1
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p236_LTJ_sgRNAFoxp3sf/J
Plasmid#82676PurposesgRNA targeting murine Foxp3 scurfy. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting Foxp3 sf/J
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p204_LTJ_sgRNACD45.2_R2
Plasmid#82673PurposesgRNA targeting murine CD45.2 region 2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting CD45.2 region 2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
Plasmid#118156PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-EGFP under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9
Plasmid#126760PurposeExpression plasmid for human codon-optimized Blackjack-SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of WT SpCas9.DepositorInsertB-SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationamino acids 1005-1013 replaced with two glycinePromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-eSpCas9
Plasmid#126761PurposeExpression plasmid for human codon-optimized increased fidelity Blackjack-eSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than eSpCas9.DepositorInsertB-eSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A; K1003A; R1060A; amino acids 1005-1013 repl…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-evoSpCas9
Plasmid#126765PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-evoSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than evoSpCas9.DepositorInsertB-evoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V; Y515N; K526E; R661Q; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HypaSpCas9
Plasmid#126763PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HypaSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HypaSpCas9.DepositorInsertB-HypaSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN692A; M694A; Q695A; H698A; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60226PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-EGFP
Plasmid#71666PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-EGFP for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR
Plasmid#71667PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (DNMT3A S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only