We narrowed to 78,817 results for: TRI
-
Plasmid#69842PurposeThis plasmid encodes kinase dead PLK4 isoform 1 carrying K41M and S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
UseTags3xFLAG tag and EGFPExpressionMammalianMutationK41M-S285A-T289APromoterCMVAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-K650E
Plasmid#191757PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-K650E mutation (associated with TD2; target mutation: c.1948A>G; silent mutation added on purpose: c.1938C>T)DepositorInsertmGFP-FGFR3IIIc
UseTagsmGFPExpressionMammalianMutationc.1948A>G (p.K650E) + silent mutation c.1938C&…PromoterAvailable sinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Dakap-Venus-cpVenus-FLARE-AKAR
Plasmid#123338PurposeMitochondria-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertDAKAP-Venus-cpVenus-FLARE-AKAR
UseTagsN-terminal 30 amino acids from DAKAP1, Venus, and…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP WT
Plasmid#197567PurposeExpression of sfGFP WT with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6) (4x copies)
UseTagsV5-His6ExpressionMammalianMutationPromoterCMV and U6/H1Available sinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AFDN_PDZ_1
Plasmid#103938PurposeProtein expression and purification of TRITHORAX PDZ domainDepositorInsertAFDN (AFDN Human)
UseTagsGSTExpressionBacterialMutationcontains AA983-1110 of AFDNPromotertacAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #2
Plasmid#83087PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorInsertshID2 (ID2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRF.1 udsVenus (P_JUND)
Plasmid#58692PurposeA rapidly responsive reporter of endogenous JUND promoter activity (Lentiviral expression vector for reporter ultradestabilized Venus)DepositorInsertendogenous promoter of JUND (JUND Human)
UseLentiviralTagsudsVenusExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS2144
Plasmid#104357PurposeAAV plasmid with smCBA promoter driving expression of emerald GFP (EmGFP) reporterDepositorInsertssAAV-smCBA-EmGFP
UseAAVTagsExpressionMutationPromotersmCBAAvailable sinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
GFP scFv [N86/44]
Plasmid#206743PurposeMammalian Expression of GFP scFV. Derived from hybridoma N86/44 scFv.DepositorInsertGFP (Aequorea victoria) recombinant scFV
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-NLS-BirA-2A-mCherry_Ras
Plasmid#80067PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterBeta-actin2Available sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-cytoBirA-2A-mCherry_Ras
Plasmid#80066PurposeBeta-actin2 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterBeta-actin2Available sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge (pos. CTRL)
Plasmid#117327PurposeDual luciferase assay positive control for miR-124 bindingDepositorInsertmiR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterMurine PGK-1Available sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
139H2_HC
Plasmid#206201PurposeFor recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.DepositorInsertanti-MUC1 antibody 139H2 heavy chain (Ighg1 Mouse)
UseTags-AAAHHHHHHHHExpressionMammalianMutationPromoterCMVAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge_rev(neg. CTRL)
Plasmid#117326PurposeDual luciferase assay negative control for miR-124 bindingDepositorInsertreverse miR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterMurine PGK-1Available sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-G380R
Plasmid#191755PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-G380R mutation (associated with ACH; target mutation: c.1138G>A; silent mutation added on purpose: c.1131C>T)DepositorInsertmGFP-FGFR3IIIc
UseTagsmGFPExpressionMammalianMutationc.1138G>A (G380R) + c.1131C>T (silent mutat…PromoterAvailable sinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His K206E/K534A hTFNG
Plasmid#70133PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to release iron from the N-lobe or the C-lobeDepositorInsertN6His K206e/K534A hTFNG (TF Human)
UseTagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationchanged Lys206 to a glutamic acid and Lys534 to a…PromoterSV40Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG8Ha-SERBP1(149-400)
Plasmid#176516PurposeExpresses the human C-terminal SERBP1 149-400 construct.DepositorInsertSERBP1 149-400 (SERBP1 Human)
UseTagsHis8 tag, linker, TEV siteExpressionBacterialMutationdeleted amino acids 1-148 and 401-408PromoterT7Available sinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterMyl7 promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CreLite
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyTagsExpressionMammalianMutationPromoterCBhAvailable sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 Flag GFP 4E-BP1 Rheb15
Plasmid#112761Purposeexpress GFP-4EBP1-Rheb15DepositorInsertFlag-GFP-4EBP1-Rheb15 (EIF4EBP1 Human)
UseLentiviralTagsFlag eGFP and Rheb15ExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-cpVenus-FLARE-EKAR-EV
Plasmid#123339PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-EKAR-EV
UseTags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
K15-TK/pGL3
Plasmid#44267DepositorInsertK15 promoter (-4.8) (Krt15 Mouse)
UseMouse Targeting; Thymidine kinaseTagsHSV-1 TKExpressionMammalianMutationContains the murine K15 promoter (-4.8) fragmentPromotermurine K15 promoter (-4.8) fragmentAvailable sinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPKm-230
Plasmid#90499PurposepSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.DepositorInsertmito-tFD and mito-tFNR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialMutationPromoterZic2a enhancer driving c-fos promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3-Lyn-Venus-cpVenus-FLARE-AKAR
Plasmid#123337PurposePlasma membrane-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertLyn-Venus-cpVenus-FLARE-AKAR
UseTagsN-terminal targeting sequence from Lyn kinase, Ve…ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #1
Plasmid#83086PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorInsertshID2 (ID2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-NLS-BirA-2a-mCherry
Plasmid#79886PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseTags3x HAExpressionBacterialMutationPromoterUbiquitinAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only