172,830 results

#160246

C-term GST 3C cleavable Amp resistant bacterial expression vector

John Weir

Altmannova et al Protein Sci. 2020 Sep 21. doi: 10.1002/p

Dec. 3, 2020

Academic Institutions and Nonprofits only

#105459

to generate a riboprobe for in situ hybridazation

Peter Mombaerts

Omura et al Cell Rep. 2014 Jul 24;8(2):583-95. doi:

Feb. 5, 2018

Academic Institutions and Nonprofits only

#96890

expresses His-tagged mouse ECHB (35-475) in E.coli cells

Hening Lin

Sadhukhan et al Proc Natl Acad Sci U S A. 2016 Apr 19;11

Dec. 3, 2020

Academic Institutions and Nonprofits only

#131185

Expresses VfAU1-LOV domain (Vaucheria frigida) preceded by restriction sites

Harald Janovjak

Tichy et al J Mol Biol. 2019 May 29. pii: S0022-2836

Sept. 17, 2019

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#252303

MagLOV2 for constitutive expression in E. Coli

Harrison Steel

Abrahams et al Nature. 2026 Jan 21. doi: 10.1038/s41586

April 30, 2026

Academic Institutions and Nonprofits only

#254844

plasmid encodes (AausFP1)2-mDeg fluorogenic protein

Jiahui (Chris) Wu

Pham et al Nat Methods. 2026 Jan;23(1):165-174. doi

April 27, 2026

Academic Institutions and Nonprofits only

#254453

TK4 targeting vector containing left and right homology arms for the SH4-2 locus

Marius Wernig

Uenaka et al Cell Stem Cell. 2026 Feb 13:S1934-5909(2

April 8, 2026

Academic Institutions and Nonprofits only

#247054

Expresses GFP-tagged human Ogg1 in mammalian cells.

Cristina Cardoso

Muster et al AIMS Genet. 2017 Feb 21;4(1):47-68. doi:

April 7, 2026

Academic Institutions and Nonprofits only

#242432

The pERV3 vector expresses both VgEcR and RXR from a dicistronic mRNA transcribed under the control of the CMV promoter. This is achieved by inserting an internal ribosome entry site (IRES) between th

Hanae Sato, Robert Singer

Sato et al Nat Commun. 2021 Dec 10;12(1):7203. doi:

March 16, 2026

Academic Institutions and Nonprofits only