We narrowed to 65,473 results for: nin
-
Plasmid#43816DepositorAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only
-
hPGK_V5-APEX2-GFP
Plasmid#105285Purposedrives expression of V5-NES-APEX2-GFP from human PGK promotorDepositorInsertV5-APEX2-NES
TagsGFPExpressionMammalianPromoterhuman PGK promoterAvailable SinceOct. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMU-TPr
Plasmid#61189PurposeFluorescent reporter for tonoplast AtTIP1-1-mCherry expressed under AtUBQ10 promoterDepositorInsertAtTIP1-1
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-UbE2M
Plasmid#15798DepositorAvailable SinceSept. 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ782 - HygroR
Plasmid#190933PurposeHygromycin resistance co-injection markerDepositorInsertHygromycin resistance gene
ExpressionWormPromoterrps-0Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-LiLac
Plasmid#184570PurposeFluorescent reporter for lactate (with lifetime and intensity response); expresses in mammalian cells and can be packaged as AAVDepositorHas ServiceAAV8InsertLiLac fluorescent sensor of lactate
UseAAVTagsHis7ExpressionMammalianPromoterCAGAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC1A5
Plasmid#131974PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC1A5 (SLC1A5 Human)
ExpressionMammalianAvailable SinceOct. 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET30a-HS-Tn5
Plasmid#127916PurposeProkaryotic expression of Hyperstable Tn5 (HS-Tn5) for Illumina library preperation. Developed for the large scale ChIP-Seq and ATAC-Seq experiments for the fruitENCODE and Maize Cistrome projects.DepositorInsertHyperstable Tn5
TagsE coli elongation factor Ts and Mxe intein - Chit…ExpressionBacterialMutationE54K, L372PPromoterT7Available SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PCBP1
Plasmid#16177DepositorInsertPoly(rC) binding protein 1 (PCBP1 Human)
ExpressionMammalianAvailable SinceJan. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HyPer-DAAO-NES
Plasmid#119164PurposeFusion of hydrogen peroxide fluorescent biosensor HyPer and D-amino acid oxidase; excluded from nucleus. Allows H2O2 production/detection by adding D-amino acids. AAV expression vector; CMV promoter.DepositorInsertHyPer-DAAO-NES
UseAAVTagsNESExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGF196
Plasmid#97005PurposeExpresses LEMD2-mCherry in mammalian cells under a crippled promoterDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG2/λ
Plasmid#50367PurposeExpresses grass pollen allergen Phl p 7 specific human IgG2/λ antibody isotype (102.1F10-IgG2/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 2 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOS016: roGFP2-Orp1 H2O2 oxidation sensor (cytosolic)
Plasmid#163058PurposeroGFP2-Orp1 H2O2 oxidation sensor (cytosolic)DepositorInsertroGFP2-Orp1
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry
Plasmid#78931PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plantsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
phMYT1L-N106
Plasmid#60861PurposeExpresses MYT1L under the EF1a promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR-JNKKTRClover
Plasmid#59139PurposeORF encoding JNK KTR mClover flanked by Gateway sequencesDepositorInsertJNK Kinase Translocation Reporter (MAPK8 Human, Mouse)
Available SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2 hSmad1-EVE
Plasmid#22993DepositorAvailable SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only