We narrowed to 938 results for: TDT
-
Plasmid#96904Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 240 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMUH_unc84_tdTFlag
Plasmid#46024DepositorInsertUNC-84 (unc-84 )
Use10xuas-phi31-expression vectorTagstdTomatoMutationTwo amino acid mutations (F279L and L500P) compar…Promoter10XUASAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT480GFP
Plasmid#96905Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 480 interrupted CTG repeats in exon 15DepositorInsertEGFP and human DMPK exons 11-15 with 480 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-ER-5
Plasmid#58098PurposeLocalization: Endoplasmic Reticulum, Excitation: 554, Emission: 581DepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-CA tdTomato
Plasmid#159095PurposePB-CA tdTomato piggyBac transposonDepositorInserttdTomato
UsePiggybacExpressionMammalianAvailable SinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter_1_SA-2x
Plasmid#79369PurposeAssays activity of transcriptional activators fused to SA Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT12nGFP
Plasmid#80420Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 12 CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_D2A_tdTomato
Plasmid#184045PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using a dual 2A peptide sequence (P2AT2A)DepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Dual 2A Peptide Sequence
ExpressionMammalianPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter1_SP-2x
Plasmid#79370PurposeAssays activity of transcriptional activators fused to SP Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceApril 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
STAgR_tdTomato
Plasmid#102993PurposeCan be used as backbone for a STAgR reactionDepositorTypeEmpty backboneUseCRISPR; Pcr template for stagr vectorsPromoterU6Available SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-ER-3
Plasmid#58097PurposeLocalization: Endoplasmic Reticulum, Excitation: 554, Emission: 581DepositorAvailable SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGB_RT_tdTomato_li
Plasmid#136964PurposeGoldengate/Greengate N-tag module, containing tdTomato fused to a flexible linkerDepositorInserttandem Tomato
ExpressionBacterialAvailable SinceJan. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Th-tdTomato
Plasmid#159460PurposeTargeting vector to TH gene locus for induction of P2A-fused tdTomato, with floxed PGK-puroR drug resistant cassetteDepositorInsertP2A-tdTomato
UseCre/LoxTagsP2AExpressionMammalianPromoterEndogenous THAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
MXS_tdTomato
Plasmid#62407PurposeMXS_chaining vector with tdTomatoDepositorInserttdTomato
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
ptdTomato.LIC.HXGPRT
Plasmid#83365PurposePlasmid contains LIC cassette upstream of an in-frame copy of tdTomato and HXGPRT selectable marker cassette for endogenous tagging on the gene locusDepositorInserttdTomato
UseToxoplasma gondiiTagstdTomatoAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA_tdtomato_reporter_1_ST1_2x_binding
Plasmid#79368PurposeAssays activity of transcriptional activators fused to ST1 Cas9DepositorInserttdtomato
UseCRISPRExpressionMammalianAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pATDt
Plasmid#249499PurposeExpresses tdTomato – Monodirectional chloroplast expression vector (psbH Rescue) in Chlamydomonas Reinhardtii photosynthetically deficient strain CC4388DepositorInserttdTomato (red fluorescence)
UseChlamydomonas reinhardtii chloroplast genomeExpressionBacterialMutationtdTomato results from the fusion of two copies of…PromoterThe psbD/ 5′ UTR, a light-activated chloroplast p…Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only