We narrowed to 23,130 results for: Sis
-
Plasmid#224428PurposeExpress AzaM in E. coliDepositorInsertazaM
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaC
Plasmid#224424PurposeExpress AzaC in E. coliDepositorInsertazaC
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaD
Plasmid#224425PurposeExpress AzaD in E. coliDepositorInsertazaD
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaB
Plasmid#224423PurposeExpress AzaB in E. coliDepositorInsertazaB
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaG
Plasmid#224427PurposeExpress AzaG in E. coliDepositorInsertazaG
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaE
Plasmid#224426PurposeExpress AzaE in E. coliDepositorInsertazaE
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DMRT1
Plasmid#222571PurposePiggyBac transposon plasmid for doxycycline inducible expression of DMRT1DepositorInsertDMRT1 (DMRT1 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DMRTC2
Plasmid#222548PurposePiggyBac transposon plasmid for doxycycline inducible expression of DMRTC2DepositorInsertDMRTC2 (DMRTC2 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-MEIOSIN
Plasmid#222551PurposePiggyBac transposon plasmid for doxycycline inducible expression of MEIOSINDepositorInsertMEIOSIN (LOC388553 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DPPA3
Plasmid#222578PurposePiggyBac transposon plasmid for doxycycline inducible expression of DPPA3DepositorInsertDPPA3 (DPPA3 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-CTCFL
Plasmid#222546PurposePiggyBac transposon plasmid for doxycycline inducible expression of CTCFLDepositorInsertCTCFL (CTCFL Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-3xFLAG-SMAD9-active
Plasmid#222580PurposePiggyBac transposon plasmid for doxycycline inducible expression of 3xFLAG-SMAD9DepositorAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(EP)-blast-mNG
Plasmid#221051PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(VSG)-blast-mNG
Plasmid#221050PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2:GFP
Plasmid#218565PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1:GFP
Plasmid#218564PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pUC18T-mini-Tn7T-hph-Ptac-VSVG
Plasmid#218365PurposeEmpty backbone for Tn7-site insertion with lacIq-Ptac expression system and C-terminal VSVG fusionsDepositorTypeEmpty backboneTagsVSVGExpressionBacterialAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBi2FC-N-MPK5-P2A:mCherry
Plasmid#216136PurposeControls for Bicistronic BiFCDepositorInsertMPK5 (MPK5 Mustard Weed)
ExpressionPlantAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gATRIP_A
Plasmid#211537PurposesgRNA-A against ATRIPDepositorInsertsgRNA ATRIP
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12720
Plasmid#212704PurposegRNA targeting to the gene 4HPPD locusDepositorInsertgRNA targeting to the gene 4HPPD locus
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK201
Plasmid#207131PurposeType 2 ptac promoter partDepositorInsertptac promoter
ExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2 RPS28 UTR1 WT
Plasmid#203157PurposeRPS28 UTR luciferase assay plasmid (WT UTR1, sites 1 and 2)DepositorInsertRPS28 UTR (RPS28 Human)
UseLuciferaseAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB605-GBSSI
Plasmid#213867PurposeBinary vector for the expression of GBBSI fused to the sGFP in plants (for Agrobacterium-mediated genetic transformation.)DepositorInsertGRANULE-BOUND STARCH SYNTHASE I (GBSSI) (GBSS1 Mustard Weed)
ExpressionBacterial and PlantAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-GBSSI
Plasmid#213866PurposeBinary vector for the expression of GBBSI fused to the tagRFP in plants (for Agrobacterium-mediated genetic transformation.)DepositorInsertGRANULE-BOUND STARCH SYNTHASE I (GBSSI) (GBSS1 Mustard Weed)
ExpressionBacterial and PlantAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSK-Spsg
Plasmid#214351PurposeExpresses cloning backbone for SpCas9 sgRNADepositorInsertSpCas9 tracrRNA
ExpressionMammalianAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xABRE_A
Plasmid#185803PurposeA synthetic ABA signaling reporter designed by multimerization of ABRE (7bp) and its flanking sequences from the ABI1 promoterDepositorInsert6xABRE(ABI1)+-86MP+erGFP
ExpressionPlantAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPCTΩSP0021
Plasmid#187561PurposeModule for copper-inducible expression of firefly luciferase and nanoluc luciferase driven by minimal synthetic promoters with binding sites for CUP2DepositorInsertFirefly Luciferase
ExpressionPlantAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only