We narrowed to 26,822 results for: STI
-
Plasmid#186365PurposeEntry clone with ORF encoding Ci-Snail cis-regulatory region flanked by Gateway recombination sequencesDepositorInsertSnail regulatory sequence
UseProtein expressionPromoterT7 promoterAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-R4-bpFOG-L5
Plasmid#186369PurposeEntry clone with ORF encoding Strong basal promoter of FOG flanked by Gateway recombination sequencesDepositorInsertBasal promoter of the Friend Of Gata gene
UseProtein expressionPromoterT7 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L3-pFOGl-L5
Plasmid#186364PurposeEntry clone with ORF encoding Ci-FOG cis-regulatory region flanked by Gateway recombination sequencesDepositorInsertFriend Of Gata regulatory sequence
UseProtein expressionPromoterT7 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-miniTurbo-V5-MAPK4_IDG-K
Plasmid#189906PurposeGateway destination clone of MAPK4 (human) tagged with N-terminal miniTurbo-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertMAPK4 (MAPK4 Human)
UseLentiviral; Gateway destinationTagsminiTurbo-V5ExpressionMammalianPromoterUbiquitinAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-HIPK1-V5-miniTurbo_IDG-K
Plasmid#189886PurposeGateway destination clone of HIPK1 (human) tagged with C-terminal V5-miniTurbo for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertHIPK1 (HIPK1 Human)
UseLentiviral; Gateway destinationTagsV5-miniTurboExpressionMammalianPromoterUbiquitinAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-miniTurbo-V5-HIPK4_IDG-K
Plasmid#158185PurposeGateway destination clone of HIPK4 (human) tagged with N-terminal miniTurbo-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertminiTurbo-V5-HIPK4 (HIPK4 Human)
UseLentiviral; Gateway destinationTagsminiTurbo-V5ExpressionMammalianMutationA670T, H813Y- please see depositor commentPromoterUbiquitinAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-STKLD1-V5-miniTurbo_IDG-K
Plasmid#189916PurposeGateway destination clone of STKLD1 (human) tagged with C-terminal V5-miniTurbo for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertSTKLD1 (C9orf96 Human)
UseLentiviral; Gateway destinationTagsV5-miniTurboExpressionMammalianPromoterUbiquitinAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-CLK4-V5-miniTurbo_IDG-K
Plasmid#189913PurposeGateway destination clone of CLK4 (human) tagged with C-terminal V5-miniTurbo for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertCLK4 (CLK4 Human)
UseLentiviral; Gateway destinationTagsV5-miniTurboExpressionMammalianPromoterUbiquitinAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-ADCK2-V5-miniTurbo_IDG-K
Plasmid#189908PurposeGateway destination clone of ADCK2 (human) tagged with C-terminal V5-miniTurbo for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertADCK2 (ADCK2 Human)
UseLentiviral; Gateway destinationTagsV5-miniTurboExpressionMammalianPromoterUbiquitinAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA
Plasmid#186407PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA
Plasmid#186397PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA
Plasmid#186396PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned gene of interest under control of a regulatory sequence cloned in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L3-a-element-L4
Plasmid#186366PurposeEntry clone with ORF encoding Otx cis-regulatory region flanked by Gateway recombination sequencesDepositorInserta-element early Otx neural enhancer
UseProtein expressionPromoterT7 promoterAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar-matMYC
Plasmid#115641PurposeFor targeted integration and inducible expression of a human NODAL splice variant (with an N-terminal MYC tag on the mature peptide) using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-MYC-DYK-N72A-N199A
Plasmid#115252PurposeFor mammalian expression of the human NODAL open reading frame (with two mutated N-glycosylation sites) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-MYC-DYK-C312A
Plasmid#115253PurposeFor mammalian expression of the human NODAL open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-C302S
Plasmid#115254PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-C302A
Plasmid#115255PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-N328A
Plasmid#115246PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated N-glycosylation site) with a C-terminal MYC-DYK tagDepositorInsertNODAL splice variant (NODAL Human)
TagsMYC-DYKExpressionMammalianMutationN328APromoterCMVAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-HA
Plasmid#186406PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0033
Plasmid#185624PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-CTCGDepositorInsertNbU6-2
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0032
Plasmid#185623PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-TTCGDepositorInsertNbU6-1
UseCRISPR and Synthetic BiologyAvailable SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB106
Plasmid#185065PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion including C-terminal half of Nup1 C-terminal FG domainDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated so C-terminal h…Available SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
FAK C-term
Plasmid#186147PurposeFor expresseion of recombinant FAK c-terminal domain in E. coliDepositorAvailable SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2402-Tier1-PhCMV-BlastR
Plasmid#169494PurposeTier-1 vector encoding PhCMV-driven blasticidin resistance gene BlastR (PhCMV-BlastR-pA).DepositorInsertPCMV-driven blasticidin-S deaminase
ExpressionMammalianPromoterPhCMVAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC-9-35S-11
Plasmid#176881PurposeMoClo Level 0 plasmid, contains 35SDepositorInsert35S terminator
ExpressionPlantMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-NcPAN2_1-390_Y
Plasmid#148103PurposeBacterial Expression of NcPAN2_1-390DepositorInsertNcPAN2_1-390
ExpressionBacterialAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP
Plasmid#178074PurposeInsect cell expression of ZZ-TEV-MZT2-3C-mEGFPDepositorAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCm N-term SMT3 NikJC199U
Plasmid#174210PurposeExpression plasmid with a TEV removable C-term 8xHis Tag, an N-term SUMO tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCm C-term SMT3 NikJC199U
Plasmid#174362PurposeExpression plasmid with a TEV removable C-term 8xHis Tagged SUMO tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, SMT3, and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCm N-term MBP NikJC199U
Plasmid#174364PurposeExpression plasmid with a TEV removable N-term MBP tag, a TEV removable C-term 8xHis tag, and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis, MBP, and TEVExpressionBacterialPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0058
Plasmid#177022PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol 8-oxidase; geraniol-10-hydroxylase; CYP76B6
UseSynthetic BiologyAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lentiguide-Blast-eNMU710
Plasmid#172658PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 710-bp deletion on e-NMU locusDepositorInsertpegRNA-eNMUA/pegRNA-eNMUB
UseCRISPRAvailable SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0905
Plasmid#177068PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of gal4AD-phiC31 driven by 35S promoterDepositorInsertgal4AD-phiC31
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL126
Plasmid#168360PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertTraes_2DL_772C0DE04.1
ExpressionYeastAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL125
Plasmid#168359PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertTraes_6DL_CA8732F66.1
ExpressionYeastAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL124
Plasmid#168358PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertTraes_2DL_6AE412E72.1
ExpressionYeastAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL123
Plasmid#168357PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertTraes_1AS_6B49D5A701.1
ExpressionYeastAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL122
Plasmid#168356PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertTraes_1BS_20BD939821.2
ExpressionYeastAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only