We narrowed to 4,307 results for: ARA-2
-
Plasmid#15466DepositorInsertIkB kinase beta-KM (Ikbkb Mouse)
UseTagsFlagExpressionMammalianMutationchanged Lysine at 44 to AlaninePromoterAvailable sinceOct. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLD1
Plasmid#160805PurposeExpress POLD1DepositorInsertPOLD1 (POLD1 Human)
UseRetroviralTagsExpressionMutationCodon optimized C-terminal 230 amino acidsPromoterAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorInsertOptoFGFR1-Y766F (FGFR1 Human, Mustard Weed)
UseTagsmCitrineExpressionMammalianMutationPromoterCMVAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET51b-Strep-hAGT-His
Plasmid#167276PurposeOverexpression of the human o_-alkylguanine-dna alkyltransferase in E. coliDepositorInserthAGT (AGT Human)
UseTagsHis x10 and Strep-tagExpressionBacterialMutationPromoterT7Available sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp2-a C2AB
Plasmid#40051DepositorInserthSlp2-a C2AB (SYTL2 Human)
UseTagsEGFPExpressionMammalianMutationC2AB domains only (aa 597-910)PromoterCMV promoterAvailable sinceOct. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Slp2-a E11A/R32A
Plasmid#40055DepositorInsertSlp2-a E11A/R32A (Sytl2 Mouse)
UseTagsEGFPExpressionMammalianMutationGlutamate 11 to Alanine, Arginine 32 to AlaninePromoterCMV promoterAvailable sinceNov. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Btsz2
Plasmid#40068DepositorInsertBtsz2 (btsz Fly)
UseTagsEGFPExpressionMammalianMutationPromoterCMV promoterAvailable sinceOct. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1_GST-GBRPL1
Plasmid#223729PurposeExpression of recombinant protein for purificationDepositorInsertGABARAPL1 (GABARAPL1 Human)
UseTagsGSTExpressionBacterialMutationaa 2-116 only, with Glycine exposedPromoterAvailable sinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc
Plasmid#226718PurposePlasmid enabling yeast-mediated expression and secretion of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
UseTagsHA tag and Mating factor alpha secretion signalExpressionYeastMutationPromoterpTEF1Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_FtoW
Plasmid#224254PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_FtoWDepositorInserthnRNPA1_FtoW (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationF17W, F25W, F31W, F37W, F43W, F62W, F69W, F78W, F…PromoterT7Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGhMeCP2 (pc3972)
Plasmid#212033PurposeExpresses human MeCP2 tagged N-terminal to Halo-tagDepositorInsertMeCP2 (MECP2 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion (NT96)
Plasmid#50914PurposeExpresses human NKCC1 with truncation of N-terminus and mutations at P676C I730C. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationP676C I730C N-term deletion of aa13-222 in hNKCC1…PromoterCMVAvailable sinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V A735C (NT549)
Plasmid#50910PurposeExpresses human NKCC1 C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationC723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable sinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C C723S C724V A735C (NT847)
Plasmid#50865PurposeExpresses human NKCC1 A675C C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationA675C C723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable sinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V V729C (NT543)
Plasmid#50907PurposeExpresses human NKCC1 C723S C724V V729C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationC723S C724V V729C in hNKCC1 in NT17PromoterCMVAvailable sinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V W733C (NT547)
Plasmid#50909PurposeExpresses human NKCC1 C723S C724V W733C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationC723S C724V W733C in hNKCC1 in NT17PromoterCMVAvailable sinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V F728C (NT542)
Plasmid#50906PurposeExpresses human NKCC1 C723S C724V F728C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFPExpressionMammalianMutationC723S C724V F728C in hNKCC1 in NT17PromoterCMVAvailable sinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only