We narrowed to 27,700 results for: CAL
-
Plasmid#115259PurposeFor mammalian expression of the human NODAL open reading frame (with a mutated Cysteine residue) with an internal DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only
-
NODALvar-matDYK
Plasmid#115260PurposeFor mammalian expression of a human NODAL splice varaint open reading frame with an internal DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-C312S
Plasmid#115263PurposeFor in vitro transcription of human NODAL open reading frame (with a mutated Cysteine residue) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-N72A-N199A
Plasmid#115264PurposeFor in vitro transcription of human NODAL open reading frame (with two mutated N-glycosylation sites) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-matNODALvar-HIS
Plasmid#115265PurposeFor bacterial recombinant protein production of the mature peptide of a human NODAL splice variantDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK
Plasmid#115245PurposeFor mammalian expression of a human NODAL splice variant open reading frame with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-matMYC
Plasmid#115249PurposeFor mammalian expression of a human NODAL splice variant open reading frame with an internal MYC tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-T7TS
Plasmid#115251PurposeFor in vitro transcription of a human NODAL splice variant open reading frame RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-chi28TAG31TAG
Plasmid#188996PurposeExpress chimadanin with TAG at 28 and 31 positionDepositorInsertChimadanin with TAG at 28 and 31position
ExpressionBacterialAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-chi31TAG
Plasmid#188985PurposeExpress chimadanin with TAG at 31 positionDepositorInsertChimadanin with TAG at 31 position
ExpressionBacterialAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_DUX4_KBM
Plasmid#187800PurposeDUX4 with KBM (p. E414-L424 deletion) with MAC-C tagDepositorAvailable SinceSept. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_NTRK3
Plasmid#187796PurposeMAC-tagged gene expression of human NTRK3DepositorInsertNTRK3 (NTRK3 Human)
ExpressionMammalianAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
EGFP-Plekhh1-FERM
Plasmid#187371PurposeExpresses human Plekhh1-FERM labelled with EGFPDepositorInsertPlekhh1-FERM
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Plekhh1-CTer
Plasmid#187369PurposeExpresses human Plekhh1-CTer labelled with EGFPDepositorInsertPlekhh1-CTer
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Plekhh1-NTer
Plasmid#187368PurposeExpresses human Plekhh1-NTer labelled with EGFPDepositorInsertPlekhh1-NTer
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB465
Plasmid#185098PurposeNMA111-GFP with NLS1 deleted under endogenous promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationNMA111DNLS1-GFPAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB466
Plasmid#185099PurposeNMA111-GFP with NLS1 and NLS2 deleted under endogenous promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationNMA111DNLS1DNLS2-GFPAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB467
Plasmid#185100PurposeNMA111-GFP with NLS2 deleted under endogenous promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationNMA111DNLS2-GFPAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28c_S(-31)-M30_dT7term
Plasmid#112253PurposeExpresses the S(-31)-M30 apta-FRET RNA origami structure.DepositorInsertS(-31)-M30 apta-FRET RNA origami with T7 promoter and terminators.
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28c_S*5-M5_dT7term
Plasmid#112254PurposeExpresses the S*5-M5 apta-FRET RNA origami structure.DepositorInsertS*5-M5 apta-FRET RNA origami with T7 promoter and terminators.
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-EnR
Plasmid#185497PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationfusion of winged helix domain with EnR domainAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
SITS-ccdb-mCherry
Plasmid#118753PurposeMultisite gateway destination vector for 3' tagging with mCherry for cell free expression. Parton lab clone FFFDepositorInsertccdb
TagsmCherryAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-mCerulean-tDeg
Plasmid#185401PurposemCerulean-tDeg fluorogenic proteinDepositorInsertmCerulean-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NK85
Plasmid#176611PurposeTo minimize dimerization between FcRg transmembrane domains, as this cysteine forms a disulfide bridge between y chains. To manipulate ligand spacing.DepositorInsertFCERG
UseLentiviralTagsEGFP and HA, SNAP-tagExpressionMammalianMutationC25AAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
NK83
Plasmid#176610PurposeTo measure Syk intensity in response to ligand clustering using DNA origamiDepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK45 pHomL-RPL18Bp-GFPdropout-SSA1t-HomR (AmpR)
Plasmid#179029PurposeParent vector for markerless yeast integration cassettes with untagged genesDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK44 pHomL-TEF2p-GFPdropout-SSA1t-HomR (AmpR)
Plasmid#179028PurposeParent vector for markerless yeast integration cassettes with untagged genesDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TARG1
Plasmid#172577PurposeFor gateway cloning of C-terminal tagged TARG1 constructs.DepositorInsertTARG1 (OARD1 Human)
UseGateway cloningAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-mtIF3-Dendra2
Plasmid#182371PurposeDendra2-based translation reporterDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH3137
Plasmid#179617PurposePunc-4::GCaMP6::RFP unc-54 3' UTR C.elegans A-MNs and others expression of GCaMP6::RFPDepositorInsertGCaMP6
TagsRFPExpressionWormPromoterPunc-4Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-Dm4E-T-Y10AL15A_D
Plasmid#146153PurposeInsect Expression of Dm4E-T-Y10AL15ADepositorInsertDm4E-T-Y10AL15A (4E-T Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-Dm4E-T_D
Plasmid#146150PurposeInsect Expression of Dm4E-TDepositorInsertDm4E-T (4E-T Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
E6SCX5
Plasmid#163275PurposeInducible expression of UniProt identifier E6SCX5DepositorInsertE6SCX5
Tags10xHis and T7ExpressionBacterialPromoterT7Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCm No carrier NikJC199U
Plasmid#174361PurposeExpression plasmid with a TEV removable C-term 8xHis Tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pH6HTC_MAPRE1-Halo
Plasmid#175345PurposeProduction of HaloTag fusion proteinDepositorAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMPRMA43
Plasmid#172944PurposepQE30 encoding Wzz mutant i191DepositorInsertShigella flexneri wzz i191 mutant gene
Tags6xHisExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-ccdb
Plasmid#141067PurposeMultisite gateway destination vector for cell free expression (takes two cassettes). Parton lab clone JBODepositorInsertccdb
UseSynthetic BiologyAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-ccdb-EGFP
Plasmid#118752PurposeMultisite gateway destination vector for 3' tagging with EGFP for cell free expression. Parton lab FEXDepositorInsertccdb
TagsEGFPAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-mCherry-ccdb
Plasmid#118629PurposeMultisite gateway destination vector for 5' tagging with mCherry for cell free expression. Parton lab clone FKZDepositorInsertccdb
TagsmCherryAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only